Higher classification of Skippers, or
who Giant-Skippers are

1.) We don't know the exact position of Giant Skippers in the tree.
==================================================================
DNA sequences did not give an unambiguous answer.
Thus Warren et al. proposed to place them in a group called:
*Incertae sedis*. See what it means:
http://en.wikipedia.org/wiki/Incertae_sedis


2.) Re: "describe Meg position in a tree".
==================================================================
Looking at Warren tree (numbers by each branch are the clade numbers),
Megs (clade #136) are placed (ignoring the clade #134, which is probably 
wrong, as we all agree) within a group of very diverse mostly Old-Word 
skippers: African, Asian, and some American, for instance Ruby-Eyes.

Thus, generally speaking, Megs are branching off after
AERO, which is an interesting group very well separated from the rest, 
probably worthy of a subfamily rank, in my opinion, and before
BAOR, which are not so special group of grass skippers.

See: http://www.butterfliesofamerica.com/knowhow/Htree.htm

3.) Re: "Meg rank".
==================================================================
If we accept that taxonomic groups should be monophyletic (which many are 
ready to do), and if we accept major groups in Warren tree are placed 
correctly (which some of us have problems with), then to make Megs a

family:
-------
they need to be moved to the root of the tree, and their branch should 
branch off before COEL, i.e. "Colias" branch should join Meg branch, i.e.
clade #3 should hold Megs (they will have #19) on one side + all other 
skippers (clade #4) on the other side.

Why? Because all other skippers are a family, and another family cannot 
branch inside it, since in this case the first family will not be 
monophyletic. So, Megs should be sister with all other skippers.

Can you imagine that Megs branch off at the root?

subfamily:
----------
they need to be moved at least just below Trapezitinae, and be placed 
instead of #110. I.e. clade #110 should be carrying Megs.

Why? Because Trapezitinae is the "last" subfamily to diverge prior to 
Megs, and to keep Hesperiinae monophyletic with the exclusion of Megs, 
they need to occupy position BETWEEN Trapezitinae and Hesperiinae.

Can you imagine that Megs branch off just after Trapezitinae?

One caveat. Using the logic of the strongest and longest branches in the 
tree being "high" rank (provided monophyly), AEROs suit the subfamily 
rank, thus, if AEROs are "upgraded" to a subfamily, and Meg branch is 
moved to the position #113, they can be a subfamily too.

Can you imagine that Megs branch off just after AEROs?


tribe:
--------
due to Meg distinctness, I suggest they should be a tribe be definition. 
It does not make sense to unite them with any other world-group of 
skippers in a single tribe, as the similarity is not there. I looked at 
essentially ALL skipper genera worldwide, and I did not see an obvious 
affinity to any of them. Maybe smarter people will see something, but it 
is not apparently obvious. Tribal level everywhere else means a good 
"jizz" level of similarity, and I think we should keep it at that.

No matter where they branch off, they are a tribe. How about that? 
However, in this case, to keep tribes monophyletic, all skipper groups, 
for instance all these Old-World genera, which are actually very poorly 
sampled - there are many more genera we don't have sequences for - may 
form into a bunch of tribes - maybe a dozen tribes?

Is it a bad thing? Not to me. Distinctness without readily apparent 
phylogenetic affinities is a good reason for the tribal level.

However, (and this is TOTALLY NOT scientific), I have a feeling that there
will not be a dozen Old-World skipper tribes, maybe max 4 or 5, and they 
are kind of distinct-looking, compare Perichares and Meza - I am happy to 
have them in different tribes. We can discuss Old-World for ages - they 
are amazingly interesting, diverse and colorful.


4.) Trees and sequences
=============================================================
The tree is obtained from DNA sequences by some mathematical calculation. 
However, can we look at sequences with out eyes and SEE if groupings in 
the tree are as we see them in sequences? To do that, I placed sequence 
alignment of COI gene in the middle of this page:

http://www.butterfliesofamerica.com/knowhow/Htree.htm

Species are ordered as in the tree, Meg sequences are underlined. This 
alignment has 2 very important positions. Both of them are closer to the 
beginning of the alignment. One of these positions is letter A (nucleotide
adenine) in about half of the sequences, it is shown on a black 
background.

We see that it is letter A, invariant in all the sequences from the top to
and including AERO (last sequence Thoressa_varia). In almost all other 
sequences (below AERO) there is letter T. It is not common to find such 
positions in the alignment, you see most other positions are "spotty" 
with various letters here and there. What could be the explanation for 
this position being invariant G in all "spread-wing" skippers, in HETERO, 
in TRAPEZ and in AERO?

I think the explanation is that this position DID NOT CHANGE! There were no
mutations in this position whatsoever in these groups of skippers. It was
G in the ancestor of all skippers, and it remained G in present-day 
skippers.

What happened to the remaining skippers (Hesperiinae without AERO)? In 
almost all of them this position is T. What does it mean? Most likely, it 
means that there was a mutation in the ancestor of all these skippers, 
mutation from G to T, and this position did not change in almost all 
present-day skippers.

Conclusion? All skippers "above" AERO ("closer" to the tip of the tree) 
form a monophyletic group and T is a synapomorphy of this group. This 
group contains most of Hesperiinae (without AERO). One of the consequences
of this logic could be that AEROs are not Hesperiinae, but should be their
own subfamily.

What about Megs? They have T, so they belong to this Hesperiinae group, 
and it is quite unlikely that they diverged before AEROs!!!

Conclusion 1: This G/T positions suggests that Megs diverged after AEROs.
-------------

Now, let's look at the position highlighted yellow. It is even more amazing
position. It has G in almost all skippers, and it has C (highlighted 
black) in some Hesperiinae skippers starting from TARACT. Applying similar
logic, we infer that tribes TARACT, THYM, CALPO, ANTH, MONC, and HESP form
a clade (they all have C). Moreover, Pyrrhopygopsis probably belongs with 
them too (has C). However, Megs have G, so they diverged prior to TARACT 
or Pyrrhopygopsis.

Conclusion 2: This G/C position suggests that Megs diverged before
------------                             TARACT/Pyrrhopygopsis.


This way, we "pinned" Megs down in the skipper tree - they branch off 
after AEROs (and thus are Hesperiinae), but before TARACT/Pyrrhopygopsis, 
and thus are a bit more "distinct" from others than THYM from HESP.

Can this logic be wrong? Possible, but it is not terribly likely.



5.) Tree to scale
=============================================================
Finally, I placed a tree drawn to scale after the alignment. Since there 
are so many taxa there, it is hard to see anything in this view, but it is
instructive. The tree is a bit different from Andy's tree, but the main 
features are the same.

Pay attention to the red branch. It is the longest internal branch in the 
tree, so it "lasted" the longest time. It is the most reliable partition 
of the tree into two segments: on one side of the branch (above on the 
image) are all the spread-wing skippers; on the other side of the branch 
there are all "folded-wing" skippers. But isn't this exactly how "lay" 
people see skippers? In two main groups? I think this partition is matching
very well general "look" of the skippers. Notably, HETERO (Piruna) fall on
the side of "grass" skippers, but they are clearly in between the two 
groups - spread-wing and grass. This looks very logical. This red branch 
is the strongest supported branch in the tree. Can it be wrong?

What about Megs? They are highlighted Cyan. While we can't see exactly 
where they branch out (resolution there is way too poor), we see that they
are well-inside the grass skippers. They branch off after TRAPEZ and AERO.
However, partitions after AEROs are on short branches and I would not 
trust them very much.

-------------------------------------



DNA + morphology tree from Warren et al. 2009

 

Multiple sequence alignment of COI gene. Species order is like in the tree above. Most frequent nucleotide in each position is not highlighted, Second, third and forth most frequent are highlighted red, green and cyan, respectively. Missing data and deletions (gaps shown as dashes) are highlighted in gray. Black highlight indicates some interesting positions that may unify certain groups. Yellow highlights the most special position that divides all the skippers in two groups: "true" Hesperiini and the rest. Giant-skipper sequences are underlined.

Badamia_exclamationis        ATTGGATTATTAGGATTTATTGTTTGAGCTCACCATATATTTACTGAAATATATTATTTTTACACTAATTGCAGTACTATGTTTGATTAGATCTCGTCAATATATAGACATATATTAAATTAGGGTGTATTTATACTGTTAATAAAGAATTAGTTCACTTGTATACTTATGTACTTTTATACCTCTGTTACAAAATATGTTTAGGGGGTTATTTAATCTCATCTGATTATCTTTAACCCTTATCTATAATTATTTCAATTAGATTTTAATCTA-TTTAATAGTAATTTCATTGGATAGTATATCTTATATATTTATAATTTTTATATAAAAAAAAAATTATTGAATAAATTAATCAACGAATTATTTATTCTTTAATAACCATTTTTATATAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATTATCTAACCTTAATTTACAAAATGGAGCTTCTCCTCTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTA-GGATATTTAATAATAAGTTTATTTTTT  Badamia_exclamationis       

Bibasis_sena                 ATTGGACTTTTAGGATTTATTGTTTGAGCTCACCATATATTTACAGTAATATATTTTTCTCACAGAAATTGCTGTTAAATATTTGATTAGATCTTTTCAATATATAGACTTATATTAATCTAGGATGTATTTATACTGTGGATATAGAATTAGTCCACTTGTATACTCTTGTACCTTTTTATTTTTGTTACAAAATATGTTAAGGAGGATATTTAATCCCATCTGTTTATCTTAAATCCTTACTTACAATTATTTCAATTAGGTATTATCTCA-TTTAATGGTAAATTTTTTTGATACTATATCATATATTTTTATAATTTCTTCTTTAAAATAAAAATATTGAATAAATCAATCAACGAATTGTATATTCCCTTATAACCTTTTTTATATAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGTA--TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATTTTAACTTCCAAAATAGTGCTTCACCTTTAATAGAACAAATTATTTTCTTCCATGATCATACATTAATTATTTTAATTATAATTACAATTTTAGTG-GGATATTTAATAACAAATTTATTTTTT  Bibasis_sena                

Burara_aquilina              --------ATTAGGATTTATTGTTTGAGCTCATCATATATTCACTGTAATATATTTTTTTTACTCTAATTGCTGTCTAATATTTGATTAGATTATTTCAATATATAGACCAATATTAAATTAGGATGTATTTATACTGTTAATATAGAATTAGTCCACATGTATACTTATGTACTTTTATATTTCTGATACTAAATTTGTTATGGAGGATATTTAATCTTATCTGATTATCCTAAACCCTTACCTTCAATTATTTCCATAAGATATTATTCAA-TCCAATAGCTATTACTTCTGATAGTATATCTTATATTTTTATTATTCTTATATAAAAAAAAAAATATTGAATAAATTAATCAACGTTTTATTTATTCTCTTATAACCTTTTTTATTTAATTTCATGCTAATAATATAATACCCTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TCA----TCCTTTTTTTAGAACAATGGCAACATGATCAAATCTTAATTTTCAAAATAGTGCTTCACCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACAATTTTAGTA-GGATATTTAATAATAAGTTTATTTATT  Burara_aquilina             

Choaspes_stigmata            -------------------------GAGCTCATCACATATTTACTGTAATATATTTACTTCACTCAAATTGCTGTTTATTATTTGATTAGATCTTATCAATATATAGACTAATATTAAATTAGGATGTATTTATACAGTGAATATAGAATTAGATCCCATGTATACTCTTGTACTCTTATAATTCTGACTCTAATAATGATTAGGAGGATATTCAACCTTACCAGATTATCTCTAATTCATATCTACAACTATCTCAATTAGATACTACTCCA-TTTAATAGAAATAATTTTTGATAGTATATCCTATATTTTAATTATTCTTATAGTAAAAAAAAATTATTGAATAAATTAATCAACGAATTGTTTATACCCTTATAACCATCTATATATAATCTATTGCAAATTATGTAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATAGCAACATGATCAAATTTTAATTTACAAAATAGAGCTTCTCCATTAATAGAACAAATCATTTTTTTTC------------------------------------------------------------------------  Choaspes_stigmata           

Coeliades_forestan           --------ATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGCAATATATTTAATTTACCCAAATTGCGGTAATATATTTGATTAGTTCTTTTCAATATATAGTCTTATACTTAATTAGGATGTATCTATACAGTATATAAAGAATTAGCTCTCTTGTATATACTTGTACTCTTATATTCTTGTCACTAAAAATGTTTAGGGGGATATTCAATCTTATCAGATTATCTCTAACCCTTATTTATAATTATCTCTATTAGATATTA-TTTACTTTAATAGTTATTTTATTTGACAGTATATCATATATTTTATTTATTTTTATATAAAAAAAAAATTATTGAATAAATTAATCAACGAATTGTTTATTCTCTTATAACCTTTTTTATATAATTTATTGCTAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATTTTAATTTACAAAATAGAGCTTCTCCATTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTA-GGATATTTAATAA--------------  Coeliades_forestan          

Hasora_khoda                 ATTGGTTTATTAGGTTTTATTGTTTGAGCACATCATATATTTACAGAAATATATTTAATTTACCCAAATTGCTGTATAATATTAGATTAGTTCTTTACAATATACAGACTTATATTAAATTAGGACGTATTTATACAGTAAATATAGTATTAGTTCTCATGTATACACATGTACTCCTATATCTCTGATACTAAGTATGTTTAGGGGGGTATTTAATCCTATCAGATTATCTCTAATCCATATCTATAATTATTTCTATTAGATATTATTCAA-TTTAATAGTTATTTTATTTGATAGTATATCATATATTATTATAATTGCTACATAAAAAAAAAAATATTGAATAAATTAATCAACGAATAGTATATTCTCTTATAACCCTCTTTATATAACTTATCGCTAATTATATAACACCTTTAGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------  Hasora_khoda                 

Euschemon_rafflesia          ATTGGATTATTAGGTTTTATTGTCTGAGCTCATCATATATTTACAGATATATATTTTTTTAACTCAAATTGCAGTATATTATTTGATTAGCACTTATCAATATATAGTCTTATATTAATTTAGGATGTATTTATACAGTAAATAAAGAACTAGTTCTCATGTATACTCTCGTACTTTTTTGATTTTGCCTCTAATTTTGTTTTGGAGGATATTTAATCTTATTAGTTTAAATCCAATTCATTTTTACAATTATCACTATTAGTTTTTATTTCA-TTTATTAGAAATTATACTTGATAGCATATCTTATATTTTATTATATTTTATATTAAATAAAAAATATTGAATTTATTAATCAACGTTTAAATTATCCTATAATAATCCTATTTATTAAATTTACAACTAATAATATAATACCTTTAGTAT------------------------TTTCTAATATGACAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATAGCAACATGATCTAATCTTAATTTTCAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGACCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATTTAATATTAAGATTATTTTTT  Euschemon_rafflesia         

Dyscophellus_phraxanor       ATTGGCTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGATATATATTTTTTTCACCCTAATTGCTGTATAATATCAGATTAGATCTTTACAATATACAGACTTATACTAAATTAGGATGTCTTCTTACTGTAAATAAAGAATTAGTTCACTTGTATACCTATGTACTTTTATGTTTCCGACTCTAAATTTGTTTTGGAGGATATTTAATCATATCCGATTAACTAAAATCCATATTTTCTACTATTTCTATTTGTTTTTATTTTA-TCTATTAGCTATATCATTTGATAGAATATCATATATTTTTTTTATTTTTTTATTAAATAAAATATATTGAAAAAATTAATCAACGAATAGTTTATCCCTTAATAACCCAATTTATTCAATCTTAAGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGCAATGGATTTAAACCCCATTTATAAAGAT---TTA----TCCTTTTTTTAGAA--ATGGCTACGTGATCAAATTTAAACTTACAAAATAGTAGTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTACTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Dyscophellus_phraxanor      

Cogia_calchas                ATTGGATTATTAGGATTTATTGTATGAGCTGGTCATATATTTACTGAAATATATTTTTTTTACTCCAATTGCAGTATCATATTTGATTAGTTCTCTTCAACATATAGTCTTATATTAAATTAGGATGTATTTATACAGTAAATAAAGAATTAGTTCTCATGTATTCTCTTGTACTTTTATTTTTTTGATACAAAATATGTCTTGGAGGATATTTAATCTCTTCTGATTAACTTAAATTCTTATTTATAATTATCTCTATTAGATTTTATTTTA-TTTATCTGATATAATATCCGATAGAATATCATATATTTTTATCATTATTAACTAAAAAAAAATTTACTGAAAAAATTAATCAACGATTAATTTATTCATTAATAACCTTATCTATTTAATCTTAAGCAAATTATATAATACCTTTAGAAATTA-------------------AATTTCTAATATGGCAGATTATATGCAATGGATTTAAACCCCATTTATAAAGGATTCTTA----TTCTTTTTTTAGAA--ATTGCAACATGATCAAATTTAAATTTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATTTTATATTAAGATTATTTTTC  Cogia_calchas               

Phocides_lilea               ---------TTAGGATTTATTGTTTGAGCTCATCATATATTTACTGATATATATTTTTCTATCTCTAATTGCAGTTAATTATCTGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGGTGTATTTATACAGTTAATAATGAATTAGATCTCTTGTATACATATGTACTTTTATTATTCTGTCTCAAAATATGTTTTGGAGGATATTTAATCTTATCAGATTAACACTAATGTATTTTTATAACTATTTCTATTAGATATTATTTTA-CTTATTAGATATAACCTTTGATAGTATATCATATATTTTTATTACTTTTATATAAAAAAAAATATATTGAAAAAATTAATCAACGATTAATCCATCCTTTAATAATCTTTTTCATTCAATTTATAGCAAATCATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCACCATTAATAGAACAAATTATTTTCTTTCACGACCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-GGTTACTTAATAATAACATTATTTTTT  Phocides_lilea              

Nascus_paulliniae            ATTGGTTTATTAGGATTTATTGTTTGAGCTCATCACATATTTACAGAAATATATTATTTTTTCTCTAATTGCAGTCAAATATTTGATTAGATCTTACCAATACACAGACTTATATTAAATTAGGATGTATTTATACAGTTAATAATGAATTAGTTCTCTTGTATACTTATGTACTTTTTTTTTTTTGTCACAAAGAATGATTTGGAGGTTATTTAACCATACCAGATTATCTCTAATACATTTTTATAACTATTTCTATTAGATATTATTTTA-TTCTATAGAAGTTATTCCAGATAGTATATCTTATATTTTTGTTATTATTACATTAAAAAAAAATTATTGAAAAAATTAATCAACGATTAATTTATCCTCTTATAGCCTTTTTTATTCAATTTACCTCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGG---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCACCATTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTCTTATTATAATTACTGTATTAGTA-AGTTATTTAATAATAACTTTATTT---  Nascus_paulliniae           

Udranomia_kikkawai           ATTGGATTATTAGGATTCATTGTATGAGCTCATCATATATTTACAGTAATATATTTATCCTTCTCTAATTGCTGTATATTATTTGATTAGTTCTTATCAATATATAGACTAATATTAAATTAGGGTGTATTTACACTGTAAATAATGAATTAGTTCACATGTATACTTATGCACATTTATATTTTTGTTACTAAATATGATTCGGAGGATATTTAATCTTATCAGATTAACCTTAATTCATTTTTATAATTATTTCAATTAGATATTATTCTA-TTTAGCAGATATAATTTTAGATAGAATATCATATATTTTTTTAATTTTTATATTAAAATAAATTTATTGAATAAATTAATCAACGATTAGTATATCCCTTAATAAGCATATATATTCAATTTATTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTTATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAATCTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCTTAGTT-AGTTATTTAATAATAAGATTATTTTTT  Udranomia_kikkawai          

Drephalys_kidonoi            --------------------TGTTTGAGCTCATCATATATTCACAGATATATATTTTTTTTTCTCTAATTGCTGTAAATTATTTGATTAGATCTTTTCAATATATAGACTTATATTAATCTAGGATGTATCTATACAGTAAATATAGAATTAGTCCACACGTATACTTATGCACTCTTATAATTTTGACTCTAAAAATGTCTTGGAGGATATTTAATCTTATCAGATTAACTCTAACCCATTTTATTAATTATTTCTATATGATATTATTTTA-TTTAATAGTAATAACATTAGATAGTATATCTTATATATTTTTAATTATTATATAAAAAAAAATTTATTGAACAAATTAATCAACGACATGTTTACCCTCTTATAACCTTTTTTATTCAATTTATTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATTTAAATTTACAAAATAGAGCATCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTAATTATAATTACTATTTTAGTT-GGTTATTTAATAATAAGTTTATTTTTT  Drephalys_kidonoi           

Hyalothyrus_mimcus           ATTGGATTATTAGGATTTATAGTATGAGCTCATCATATATTTACAGAAATATATTTAATTTACTCTAATTGCAGTAAAATATTTGATTAGTTCTTACCAATATACAGCCTTATATTAAATTAGGATGTATCTATACTGTTAATAAAGAATTAGTTCTCTTGTATACTCTTGTACTCTTATATTCTTGTCTCTAATTCTGTTTTGGAGGATATCTAACCTTATCAGTTTAACATAAATCCATTTTTATAATTATCTCTATTAGTTTTTATTTTA-TTTATTAGAAATTACTTTTGATAGCATATCTTATATTTTTATCATTTTTATATAAAAAAAAATTTATTGAATAAATTAATCAACGTTTAGTTTATCCTCTTATAGCCATTTATATTCAATTTATTGCAAATAATATAATACCTTTTAGAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAACTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTAATCATAATTACTATTTTAGTT-GGTTACTTAATAATAAGATTATTTTTT  Hyalothyrus_mimcus          

Bungalotis_erythus           -------------------------------------------CTGAAATATATTAATTTATCTCTAATTGCAGTCAAATATTAGATTAGTTCTTATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTTAATAAAGAATTAGTCCTCTTGTATACTCTTGCACTTTTATTCTTTTGTCTCAAAAAATGTTTTGGGGGATGTTTAACCTCATCTGATTAACTTAAATCCTTACTTATAATTATTTCAATTCGATTTTAATTTA-TTTATCAGATATAATTTTTGATAGTATATCATATATCTTTTTTATCTTTACATTAAAAAAAAATTATTGAAAAAATTAATCAACGTTTAGTATATCCATTAATAACCTTATATATTAAATTTCTTGCTAATAATATAATACCTTTAGAAA------------------------ATTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATT----------------------------------  Bungalotis_erythus          

Ocyba_calathana              ------------------ATTGTTTGAGCCCATCATATATTTACAGATATATATTTACTCAACACTAATTGCTGTAAATTATTAGATTAGTTCTTATCAATATATAGACTTATATTAACTTAGGATGTATTTATACAGTAAATAAAGAATTAGATCACATGTATACTCTTGTACTTTTATTTTTCTGTCTCTAAAAATGTTTTGGAGGATATTTAACCACATCAGATTAACCTAAATCCATTTTTATAATTATTTCTACCAGATATTATTCTA-TTTAATAGAAATTTTTTTAGATAGTATATCTTATATTCTTTTAATTTCTTTATAAAAAAAAAAATATTGAATAAATTAATCAACGATTAATTTATCCTCTTATAACCATTTTTATTCAATTTATTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCTTAGTA-GGTTACTTAATAATAAG----------  Ocyba_calathana             

Polygonus_leo                ATTGGATTACTTGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTATTTCTTCTCTAATTGCTGTTTGATATTTGATTAGATCTTATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACTGTTGATAAAGAATTAGTTCTCTTGTATACTCTTGTACTTTTATTCTTTTGCTACTAAATATGTTTTGGAGGATATTTAATCTTATCAGACTTACCCTAATCCATTTTGATAATTATTTCTATTAGATATTATTCAA-TTTAATAGAGATATTTTTTGATAGTATATCATATATTTTCATTACCATTATATTAAAAAAAATTTATTGAAAAAATTAATCAACGATTAATTTACCCATTAATAACCATATTTATTCAATCTTTTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGCGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTCTTATTATAATTACTATTTTAGTAGAGTTATTTAATAATAAG-TTATTTTTC  Polygonus_leo               

Telemiades_fides             -------------------TTGTTTGAGCTCATCACATATTTACAGAAATATATTTTTTCGACTCTAATTGCAGTAAAATATTTGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATTTATACAGTAAATAAAGAGTTAGATCTCATGTACACTCTCGTACTTTTATACTTTTGTTACTAAAAATGTCTTGGGGGATATTTAATCTTATCTGATTAACCCCAATCCCTACTGATAATTATTTCCATTAGTTATTATTCAA-TCTATTAGCCATATTTTCAGATAGCATATCTTATATAATTATAATTTTTATATAAAAAAAAATTTATTGAAAAAATTAACCAACGATTAATTTATCCATTAATAACCTTTTTTATTCAATCTTTTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCACTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATCTTTTTTCACGATCATACATTAGTTATTTTAATTATAATTACTATTTTAGTA-AGTTATTTAATAATAAGATTATTTT--  Telemiades_fides            

Proteides_mercurius          ATTGGATTATTAGGATTTATCGTTTGAGCCCATCATATATTTACAGGTATATATTATATCTACTCAAATTGCCGTTTAACATTAGACTAGTTCTTATCAATATATAGTCTTATATTAAATTAGGACGTATCTATACTGTAATCAAAGAATTAGGTCCCATGTATACTTATGCACTTTTATTCTTTTGTCACTAAACACGTTTTGGAGGTTATTCAATCTTACCCGTCTTTCATAAACCCGTATATACAATTATTACTATTAGATACTACTTTA-TTTAATAGTTATAATTTTTGACAGAATATCTTTAATATTTGTAATTTTTATATCAGAACAAAAACATTGAAAAAATTAACCAACGATTAATTTACCCACTAATAACCTTCTTTATTCAATCTTTCGCTAATAATATAATACCTTTAGTAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCTTAGTC-GGATATATAATAATAACATTATTCTTT  Proteides_mercurius         

Chioides_catillus            ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGATATATATTTTTTTTTCTCTAATTGCAGTACTATATTTGATTAGTTCTTATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTAAATATAGAATTAGTTCTCATGCATACTTATGTACTTTTATTTTTTTGCCTCTAAATTTGTTTTGGGGGATATTTAATCTTATCAGTCTTACTTAAATCCTTATATATAATTATCTCCATTAGATTCTATTTTA-TTTATTAGTTAAAACTTTTGATAGTATATCATGAATTATTTTCACTATTATATTAAAAAAAATATATTGAAAAAATTAATCAACGACCAATTTACCCATTAATAACCTTATTTATTCAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGTGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-GGTTATATAATAATAACATTATTTTTT  Chioides_catillus           

Spathilepia_clonius          ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTCACAGATATATATTTATTTCACTCTAATTGCTGTTTATTATTTGGTTAGATCTTACCAATATATAGTCTTATATTAAATTAGGATGTATCTATACTGTTAATATAGAATCAGTTCTCTTGTATACCTATGTACATTTATAATTTTGTCTCTAAACATGTTTTGGAGGATATTTAATCATATCTGACTTTCTTAAATCCTTACATATAATTATCTCTATTAGTTATTATCTCA-TTTATTAGTGATAATTTCAGATAGAATATCATGTATAATTTTTATTTTTATATTAAAAAAAATATATTGAATAAATTAATCAACGAATAATTTATCCATTAATAACCTTATTTATTCAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCTTAGTA-GGATATATAATAATAACATTATTTTTT  Spathilepia_clonius         

Urbanus_dorantes             ATTGGCTTACTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAATATATTTATTCTACTCTAATTGCAGTCAAATATTTGATTAGATCTTATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACTTGTATACTTATGTACGTCTATAATTTTGTCTCTAAAAATGTTTCGGAGGTTATTCAATCATATCAGTCTTTCTTAAATCCTTATATATAATTATTTCTACTAGATTTTATTTTA-TTTATTAGTTATTATTTTAGATAGAATATCATGAATAATTTTTATTTTTATATTAAAAAAAAAATATTGAATAAATTAATCAACGATTAATTTATCCATTAACAACCTTTTTTATTTAATTTATAGCTAATTATATAATACCTTTAGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------  Urbanus_dorantes             

Thorybes_pylades             ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTTACACTAATTGCAGTTAAATATTTGATTAGATCTTACCAATATATAGTCTTATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACTTGTATACTCTTGTACTTCTATATTTTTGTCTCTAAATATGTTTTGGAGGTTATTTAATCATACCAGTCTTTCATAAATCCTTATATACTATTATTTCTATCAGATTTTAATTTA-CTTAATAGATATTATTTTAGATAGTATATCATGAATAATTTTTATTTTTATATTAAAAAAAAAATATTGAATAAATTAATCAACGATTAATTTACCCATTAATAACCTTATTTATTTAATCTTAAGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGTGCATCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAGTTATTCTTATTATAATTACGATTTTAGTA-GGATATATAATAATAACATTATTTTTT  Thorybes_pylades            

Autochton_longipennis        ATTGGTCTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAATTATATACCTATTCTACCCAAATTGCAGTCAAATATCTGATTAGATCTTACCAATATACAGTCTTATATTAAATTAGGTCGTATTTATACAGTAAATATAGAATTAGATCACTTGTATACATATGTACATTTATATTTTTGTCTCTAAATATGTTTTGGAGGATATTCAATCTTATCAGACTTTCATAAACCCTTATTTACTATTATTTCCATTAGTTTTTATTTTA-TTTAATAGATAAAATATTTGACAGTATATCATGAATATTTATTATTTTTATATTAAAAAAAATATATTGAATAAATTAATCAACGATTAATTTACCCATTAATAATCCTTTTTATTAAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATAGAGCATCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAATTATCCTTATTATAATTACTATTTTAGTA-GGATATATAATAATAACATTATTTTTT  Autochton_longipennis       

Achalarus_albociliatus       ATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGATATATATTTATTTTACTCTAATTGCAGTTAAATATTTGATTAGATCTTTACAACATATAGCCTAATATTAAATTAGGGTGTATTTATACTGTAGATATAGAATTAGACCACATGTACACTTATGTACATTTATTATTTTGTCTCTAAATACGTTTTGGAGGTTATTCAATCATATCTGTCTTTCATAAATCCTTATATACTATTATTTCCATCAGATTTTATTCAA-TTTAATAGATGTTATTTTTGATAGTATATCATGAATAATTATTATTTTTATATTAAAAAAAAATTATTGAATTAATTAATCAACGATTAATTTACACACTAATAACCTTTTTTATTTAATTTAAAGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGTGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTTATTATAATTACTATTTTAGTA-GGATATATAATAATAACATTATTTTTT  Achalarus_albociliatus      

Urbanus_simplicius           ATTGGCTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTAATTTTACTCTAATTGCAGTAAAATATTTGATTAGATCTTTACAATATATAGTCTTATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACATGTATACTTATGTACATTTATAATTTTGTCTCTAAATATGTTTCGGAGGCTATTTAATCACACTAGTCTTTCAAAAATCCTTATATATAATTATTTCTATTAGATTTTATTTTA-TTTATTAGAAATAATTTTTGATAGTATATCATGAATAATTATAATTATTATATTAAAATAAAAATATTGAATAAATTAATCAACGATTAATTTACCCTTTAATAACCTTTTTTATTAAATTTACAGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGTGCATCACCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTTATTATAATTACTATTTTAGTA-GGATATATAATAATAACATTATTTTTT  Urbanus_simplicius          

Astraptes_fulgerator         ATTGGATTACTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTAATCTTACTCTAATTGCTGTCCTATATTTGATTAGAACTTTTCAATATATAGACATATATTAAATTAGGATGTATTCATACCGTAAATAAAGAATTAGTTCACATGTATACTTATGTACTTTTTTAATTTTGTCCCTAAATATGTTTTGGAGGACATTTAATCTTATCTGACTTACTCTAATCCTTATTTATAATTATTTCTATTTGTTTTTACTCCA-TTTACTAGAAATAATTTTTGATAGCACATCATGAATTTTCATAATTATTACATAAAAAAAAAATTACTGAAAAAATTAATCAACGATTAATTTATCCTTTAATAATCATTTTTACTCAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGA---TCA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAATTATTTTAATTATAATTACTATCCTTGTA-GGATATATAATAATATCACTATTCTTT  Astraptes_fulgerator        

Narcosius_colossus           ---------CTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTTTTTAACTCTAATTGCTGTTAAATATTTGATTAGATCTTATCAATATATAGCCTAATAATAAATTAGGATGTATCTATACTGTCAATAAAGAATTAGATCTCATGTATACTCTTGCACTTTTATACTCTTGTCTCTAAATTTGTTTTGGAGGATATTTAACCTTACCAGTCTTTCTTAAACCCATATATACTATCATTTCTATATGATTTTATTTTA-TTTAATAGTAATTTTTTCTGATAGTATATCATTAATTATTATAATTATTATATAAAAAAAAATATATTGAAAAAATTAATCAACGATTAATTTATCCTTTAATAATCATTTTTACTAAATTTAATGCTAATCATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAATCTTCAAAATAGTGCTTCTCCATTAATAGAACAAATTATTTTCTTTCATGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATATTAATAACATTATTTTTT  Narcosius_colossus          

Cabares_potrillo             -----------------------------------TATATTTACAGATATATATTTATTTTTCTCTAATTGCAGTTAAATATTTGATTAGATCTTATCAATATATAGCCATATATTAATTTAGGTTGTATTTATACAGTAATTAATGAATTAGATCTCTTGTATACCTATGTACATTTATATTTTTGTTACTAAGAATGATTTGGAGGATATTTAATCTTATCCGTCTTTCTTAAATCCTTATTTATAATTATTTCTATTAGATATTATTTTA-TTTAGTAGTAATTTTTCTTGATAGTATATATTGAATTTTTATTATTCTTATATAAAAAAAAAAATATTGAAAAGATTAATCAACGATTAATTTATCCATTAATAACCTTTTTTATTCAATCTTTTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATCTACAAAATAGTGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTACTTATAATTACTATTTTAGTA-GGATATATAATAAT-------------  Cabares_potrillo            

Aguna_asander                ATTGGATTATTAGGATTTATTGTATGAGCTCACCACATATTTACAGATATATATTTTTTTAACTCTAATTGCTGTATTATATTTGATTAGATCTTATCAGTATACAGACTTATATTAAATTAGGATGTTTTTATACTGTTGATAATGAATTAGTTCTCTTGTATACTTATGTACTTTTATATTTTTGTCTCAAAGTTTGTTTTGGAGGATATTTAATCATATCAGATTAACCTTAATCCATTTTTATAATTATCTCTATTAGATTTTATTTTA-TTTATTAGAAATATTTTTTGATAGTATATCTTGTATTATTATTATTTTTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGATTAGTTTATACATTAATAACCTTTTCTATTCAATTTATAGCAAATAATACAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TCA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATAGTGCTTCTCCATTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAGTTATTTTACTTATAAATACTATTTTAGTC-AGATATTTAATAATAAGATTATTTTTT  Aguna_asander               

Typhedanus_ampyx             ATTGGATTACTTGGATTTATTGTTTGAGCTCATCATATATTTACTGTAATATATTTATTCAACTCTAATTGCTGTTAAATATTTGATTAGATCTTATCAATATACTCTCTTATACTAAATTAGGATGTATTTATACAGTAAATAATGAATTAGATCTCTTGTATACTTATGTACTTTTTTTATTTTGACTCCAAATTTGTTTTGGAGGATATTTAACCATATCTGATTAAATTAAATCCATTTTATTAATTATTTCAATTAGATATTAATTTA-TTTATTAGTCATATTATTTGATAGAATATCATGAATCATTATTATTTTTATATCAAAAAAAAAATATTGAAAAAATTAATCAACGAATTACTTACCCTTTAATAACCTTTTTTATTTAATCTATTGCAAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTTCACGATCATACCTTAATTATTTTAATTATAATTACCATTTTAGTA-GGATATTTAATAATAAGATTATTTTTT  Typhedanus_ampyx            

Codatractus_melon            ATTGGATTACTTGGATTTATTGTTTGAGCTCATCATATATTTACTGTAATATATTTATTCAACTCTAATTGCTGTTAAATATTTGATTAGATCTTATCAATATACTCTCTTATACTAAATTAGGATGTATTTATACAGTAAATAATGAATTAGATCTCTTGTATACTTATGTACTTTTTTTATTTTGACTCCAAATTTGTTTTGGAGGATATTTAACCATATCTGATTAAATTAAATCCATTTTATTAATTATTTCAATTAGATATTAATTTA-TTTATTAGTCATATTATTTGATAGAATATCATGAATCATTATTATTTTTATATCAAAAAAAAAATATTGAAAAAATTAATCAACGAATTACTTACCCTTTAATAACCTTTTTTATTTAATCTATTGCAAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACCATTTTAGTA-AGATATTTAATAATAAGATTATTTTTT  Codatractus_melon           

Zestusa_elwesi               -------------------TTGTTTGAGCTCATCATATATTTACGGAAATATATTTTTTTAACTCTAACTGCAGTAATTTATCAGATTAGATCTCATCAATATATAGACTTATATTAATTTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACTTGTATACTTATGTACTTTTATATTCTTGTCTCTAAATTTGTTTTGGGGGTTATTTAATCTTATCAGGTTAACTTAAATCCATTTTTACAATTATTTCTATTTGTTTTTAATTCA-TTTATCAGTGATAATATTAGATAGTATATCTTGAATTTTTATTATTTTTATATTAAAAAAAAAATATTGAAAAAATTAACCAACGAATAATTTACCCATTAATAGCCTTTTTCATTCAATTTAGCGCAAATTATGTAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATAGCAACATGATCTAATTTTAATTTACAAAATAGTGCTTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATCATAATTACTATATTAGTA-AGA------------------------  Zestusa_elwesi              

Lobocla_liliana              ATTGGATTACTTGGGTTTATTGTTTGAGCTCATCATATATTTACAGATATATATCTTATTAACTCTAATTGCAGTTTATTATTTGATTAGTTCTTTACAATATATAGACTTATATTAAATTAGGATGTATTTACACAGTATATAAAGAATTAGATCACTTGTATACTTATGTACTTTTTTATTTTTGTCTCTAATTATGTTTTGGAGGTTATTCAACCTCATCAGATTAACTTAAACCCATTAATATAATTATTTCCACTTGTTTCTATTTCA-TCTAATAGAAATTACATTTGATAGTTTATCTTGAATCATTTTTATTTTTATATTAAAAAAAATATATTGAATAAATTAACCAACGATTAATTTATCCATTAATAATCTTTTTTATTCAATTTATTGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAATCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTAAATTTACAAAATAGTGCTTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATTTAATAATAAGATTATTTTTT  Lobocla_liliana             

Calliades_zeutus             ATTGGATTACTTGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTTTTTTTACTCTAATTGCAGTATGATATTTGATTAGATCTTTTCAATATATAGTCTTATAATAAATTAGGATGTTTTTATACAGTTATTAAAGAATTAGTTCTCTTGTATACCTATGTACATTTTTTTTTTTGTCTCTAAATATGTTTCGGAGGATATTTAATCTTATCTGATTATCTCTAACCCATTTATATAATTATTTCCATATGTTTTTATTTTA-TTTATTAGATATAATTTTTGATAGTATATCTTATACTTTACTTATTTTTAATTAAAATAAAAAATATTGAACTTATTAATCAACGATTAATTTACCCTTTAATAAGCCTTTTTATTCAATCTATTGCAAATTATATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATAAATTTACAAAATAGTGCTTCACCATTAATAGAACAAATCATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATTTAATAATAAGATTATTTTTT  Calliades_zeutus            

Apyrrothrix_araxes           ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTAATTTTACACTAACTGCAGTAAATTATTAGAATAGATCTTATCAATATATAGTCTTATATTAAACTTGGATGTTTTTATACAGTAAATAGAGAATTAGTTCTCATGTATACTTATGTACTTTTATTTTTTTGACTCCAAACTTATTTTGGAGGATATTTAATCTTATCAGTCTTTCACAAATCCTCTTTTACTATTATTTCAACTAGATTCTAATTCA-TTTAATAGCCATATTATTAGATAGATTACCATATATTTTTATTATTATTACATAAAAAAAAAAATATTGAAAAAATCAATCAACGAATTGTTTATTCTCTTCTAACCTTCTCTATTTAATTTATATCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATCTTAATTTTCAAAACAGAGCTTCCCCATTAATAGAACAAATTATCTTTTTTCACGATCATACTTTAATTATTTTAATTTTAATTACTATTTTAGTA-GGTTATTTAATAATATCATTATTTTTT  Apyrrothrix_araxes          

Creonpyge_creon              ATTGGACTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATCAAATTTACACTAATTGCAGTAAAATATTAGAATAGAACTTATCAATATATAGACTTATATTAAACTTGGGTGTTTCTATACAGTAAATATAGAATTAGCTCTCATGTATACTTATGTACTCTTATTTTTTTCTCTCTAAATCTATTTTGGAGGATATTTAATCTTATCAGACTTTCCTAAATCCTTTAATACTATTATTTCAATTAGTTTTTAATTTA-TCTAATAGTAATATTTTTTGATAGATTATCATATATCATTATTATTTCTACATAAAAAAAAAAATATTGAATAAATCAACCAACGAATTATTTATTCACTTCTAATCATATTTATTTAATTTATATCAAATAATATAATGCCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATTAATTTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTTTAATTACTATTTTAGTA-GGTTATTTAATAATATCATTATTTTTT  Creonpyge_creon             

Pyrrhopyge_zenodorus         ATTGGATTATTAGGATTTATTGTCTGAGCTCATCATATATTTACCGTAATATATTTACTTTTCTCTAATTGCTGTAATATATCTGAATAGATCTTACCAATATATAGACTTATATTAATTTAGGACGTTTTTATACAGTTAATGAAGAATTAGTTCTCATGTATACCTACGTACTCTTATAATTCTGATACTAAATATATTTTGGAGGTTATTTAATCTTATCAGACTTTCTCAAATCCATTAATACTATTATTACAATTAGATTTTATTTCA-TTTATTAGAAAAATTATCAGATAGATTATCATATATTTTTATAATTTTTAATTAAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATTCTCTTCTAACCTTATTTATTCTCTTTAAATCTAACTACATAATACCTTTAGAAATTAAATTAATTATTAAATTATTAATTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TCA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATAAATTTTCAAAATAGAACCTCTCCATTAATAGAACAAATTATTTTTTTTCATGACCATACACTAATTATCTTAATTATAATTACTATTTTAGTA-GGTTATTTAATGATATCACTATTTTTT  Pyrrhopyge_zenodorus        

Mysoria_ambigua              ATTGGTTTACTAGGATTTATTGTATGAGCTCATCATATATTTACCGAGATATATTTATTTTACTCTAATTGCAGTGAATTATTTGAATAGATCTTTTCAATACATAGACTTATATTAAATTAGGATGTCTTTATACTGTAGATAAAGTACTAGTTCCCATGTATACTTATGTACTTTTTTTCTTTTGTTACTAAATACATTTTGGAGGATATTTAATCTCTTCTGATTAACCTAAATCCTTTAATATAATTATTTCAATCAGATTTTAATCTA-CTTAATAGTAATTTTTTCTGATAGATTATCATATATTTTTATTATTATTACTTAAAAAAAAAAATATTGAATAAATTAATCAACGAATAATTTATTCTCTTCTAACCTTATTTATTTAATATACAGCAAATTTTATAATACCTTTAGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------  Mysoria_ambigua              

Sarbia_xanthippe             -----------AGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTAATCTAACTCTAATTGCAGTAATATATTTGAATAGACCTTATCAATATATAGTCAAATATTAATCTAGGATGTTTTTATACTGTAAATAAAGAATTAGATCCCATGTATACATATGTACTTTTTTTTTTTTGATACTAGATATACTTTGGAGGATATTTGATCACTTCTGATTAACTTAAACCCTTTAATATAATTATTTCAGTTAGATTTTAATTTA-TTTACCAGTAATATTTTTAGATAGATTATCATATATTCTTATTATTATTATATAAAAAAAAAAATATTGAATAAATTAATCAACGAATTGTTTATTCCCTTCTAATCATATTTATTAAATATGCATCAAATTTTATTTCACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATAGCAACATGATCAAACTTAAATTTACAAAATAGAGCCTCTCCATTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-GGTTATCTAATAATATCATTATTTTTT  Sarbia_xanthippe            

Elbella_scylla               ATTGGATTACTAGGATTTATTGTATGAGCTCATCATATATTCACAGAAATATATTAAATTTACACTAATTGCTGTAAAATATTTGAATAGATCTCATCAATATATAGTCTTATATTAAATTAGGATGTTTTTATACAGTAAATAAAGAGTTAGTTCTCTTGTATACTCTTGTACTTTTATTATTTTGATACAAAATTTATTTTGGAGGACATTTAACCATATCAGTCTTATACTAATCCTTTAATATAATTATTTCTATTAGATTTTACTTTA-TTTAATAGTAATAATTTTAGATAGATTACCATATACATTTATAATTCTTAATTATAAAAAAAATTATTGAATAAATTAATCAACGAATTATTTATTCTCTTCCAATCTTATTTATTTAATTTACTTCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATTTAAATTTTCAAAATGGAGCATCTCCTTTAATAGAACAAATTATTTTTTTTCACGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTA-GGTTATTTAATAACATCTTTATTTTTT  Elbella_scylla              

Parelbella_macleannani       ------------GGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTAAATTTACACCAATTGCTGTTAAATATTTGAATAGATCTTATCAATATATAGACTTATATTAGATTAGGGTGTTTTTATACTGTAAACATAGAATTAGACCTCATGTATACATATGTACTTTTATATTTTTGTTACTAAACTTATTTTGGAGGATATCCAATCATATCAGTCTTACAAAAATCCTACAATATAATTATCTCTATTAGATTTTACTTTA-TTTATTAGACATAGTTCCTGATAGATTCTCATATATATTTATTATTTCTAATTAAAAAAAAAATTATTGAAAAAATTAATCAACGAATTGTTTATCCTCTTCTAATCATATTTACTCAATTTACCTCAAATAATATAATACCCTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTAT-----------------------------------  Parelbella_macleannani      

Passova_gellias              ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTCATTTAACACAAATTGCAGTCAAATATTTGAATAGAATATACCAATATATAGACTCATATTAAACTCGGATGTTTTTACACAGTAAATAAAGAATTAGTTCCCATGTATACATATGCACTCTTATATTCTTGTCTCAAAATTCATTTTGGGGGATATCTAATCATATCAGACTTACATAAATCCTATAATATAATTATTTTAATTAGTTATTATTCCA-TCTAGTAGTAATATCTTTAGATAGTTTATCATATATTTTTATTATAATTATATTAAAAAAAAATTATTGAATAAATTAATCAACGAATTATTTATTCATTACCAACCATATATATTCAATCTATTTCAAACTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATATTAATTTTCAAAATAGAGCCTCACCTTTAATAGAACAAATTATTTTTTTTCATGACCATACTTTAATTATTTTAATTATAATCACTATTTTAGTT-GGTTATTTAATAATATCCTTATTTTTT  Passova_gellias             

Myscelus_belti               ATTGGCTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTAACACAAATTGCAGTAAAATATTTGAATAGATCTTATCAATATATAGTCTTATATTAAAATTGGATGTTTTTATACAGTAAATATAGAATTAGCTCTCATGTATACTTACGTACTTTTATATTTTTGACTCAAAATTTATTTTGGAGGATATCTAATCTTATCAGACTTACTCTAATCCTATAATATAATTATTTCAATTAGGTATTATTTTA-TTTATTAGTAACATTTTTTGATAGTTTACCATATATTTTTATTATTTTTATATCAAAAAAAAAATATTGAATAAATTAATCAACGAATTACTCATTCCTTAATAACCTTATTCATTCAATCTTAATCAAACTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTTCAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTCTTCCATGATCATACTTTAATTATTTTAATTATAATCACTATTTTAGTT-GGATACTTAATAATATCTATATTTTT-  Myscelus_belti              

Netrocoryne_repanda          ATTGGATTATTAGGATTTATTGTATGAGCTCATCATACATTTACAGAAATATGTTCAATTAACACTAATTGCAGTTTAATATTCGATTAGTTCTTATCAATATATAGTCTTATATTAATTTAGGTTGTATTCATACAGTGAATAAAGAATTAGTCCTCCTGTATACTCTTGTACTTTTATTATTCTGTCTCTAATTATGTTTTGGGGGATATTTAATCTTATCAGTCTTACTCTAATCATTATTATTAACTATTTCAATCAGATATTATTCTA-TTTAATAGCTATTTTTTTTGATAGATTATCATATATTTTTATTATTTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCTTTAATAGCCATATTTACTTAATTTATAGCAAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATAGCAACATGATCAAATTTAAATCTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATTTAATAATAATATTATTTTTT  Netrocoryne_repanda         

Tagiades_flesus              ATTGGGTTATTAGGATTTATTGTTTGAGCGCATCATATATTTACTGTAATATATTTATTTAACACAAATTGCAGTTTAATATTTGATTAGATCTCACCAATATATAGTCTAATATTAAATTAGGATGTATTTATACAGTAATTACTGAATTAGTTCTCTTGTATACCCATGCACTTTTATACTTTTGTCACTAAATATGATTTGGGGGATATCTAACCTTACCAGTTTAACCCTAATCCTTACCTTCAATTATTTCAATTAGGTTTTATTTTA-TTTAGTAGAAATATTATCTGATAGTATATCTTATATGTTTATTATTCTTATATAAAAAAAAAAATATTGAAAAAATTAACCAACGAATCGTTTACCCTTTAATAAGCTTATTTACTTAATTTATAGCTAATAATATAATACCTCTAGTAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTAAATTTACAAAATGGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAACTACTATTTTAGTC-AGTTACATAATGACATCTTTATTTTTT  Tagiades_flesus             

Daimio_tethys                ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAATATATCTTTTTCACTCAAATTGCCGTACATTATTTGACTTGTTTATTTCAATATATAGCCTTATATTAAATTAGGGCGTGTCTATACAGTTGACATAGAACTAGCTCTCATGCATACTTATGTACTTTTATTCTTCTGTTACTAAATACGATTTGGAGGATATTTAACCTTACCAGTATCACACTAACCCATATTTACTATTATTTCAATTAGATATTATTCTA-TTTATTAGAAATACTATTAGATAGTATATCATACATTTTTTTTATTTTTATATAAAAATAAAAATATTGAATAAATTAATAAACGAATTATTTACCCATTAATAACCTTATTTACTAAACTTATAGCAAATAATATAACACCTTTAGTAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATTGCAACATGATCAAATCTTAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGACCATACTTTAATTATTTTATTAATAATTACTATTTTAGTC-AGATACTTAATAATATCTTTATTCTTT  Daimio_tethys               

Eagris_tetrastigma           ATTGGATTATTAGGATTTATTGTATGAGCACATCATATATTCACAGATATATATTCATTTAACACCAATTGCTGTTAAATATTTGATTAGTTTATATCAATATATAGCCCAATATTAAATTAGGATGTGTCTATACAGTAAATGAAGAATTAGTTCTCTTGCATACCCATGCACTTTTATATTCCTGTCTCAAAGTATGATTTGGAGGATGTTTAACCTTATCAGCCAATAACAAATCCTTACTTATAATTATTACTATGAGATTTCGTTCTA-TTCAATAGAAACAATTTTTGATAGCATACCCTATATTATAATTATCTCTATATTAAAAAAAAAATATTAAATAAATCAATCAACAAATTATTTATCCTTTAATAAGCTTTTTTATTTAATTTACAGCAAATAATATAATGCCCTTAGATA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATTTAAATTTACAAAATAGAACTTCTCCTTTAATGGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-CCTTATTTAATATTATCATTATTTTTT  Eagris_tetrastigma          

Darpa_striata                ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGAAATATATTTATTTTACTCAAATTGCTGTAAAATATTTGATTAGATTATAACAATATATAGACTCATATTAATTTAGGATGTATTTATACAGTAAATAAAGAATTAGTTCTCTTGTATACCTATGTACTTTTTTAATTTTGTCTCTAAATATGATTTGGGGGATATTTAACCATATCAGAATTACATAAATCCTTATTTATAATTATCTCAATTAGATTTTATTTTA-CTTATTAGCTATAATTCTAGATAGTATATCATATATTATTATTATCATTATATCAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCTTTAATAATCTTCTTTATTTAATTTATAGCAAATCACACAATACCATTAGTAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATTTAATAATTTCATTATTTTTC  Darpa_striata               

Celaenorrhinus_leona         ----------TAGGTTTTATTGTTTGAGCTCATCATATATTTACTGATATATATTTACTCTACACAAATTGCTGTAAAATATTTGATTAGATCTTATCAATATATAGACTAATATTAATTTAGGATGTATTTACACAGTAATTAAAGAATTAGTTCACTTCTATACTCTTGTACTTTTTTTTTTTTGTTACTAAATATGTTTTGGAGGATATTTAATCTTATCTGTTTATCTCTAATCAATATTACTAATTATTACTATTTGATTTTATTCTA-TTTAATAGAGATAATTTTTGATAGTATCTCTTATACTCTTATTATTATTATATTAAAATAAATATATTGAAAAAATTAATCAACGAATTATCTATCCTCTTATAATCTTCTTTATTAAATTTACTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTT----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAACCTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTTTTAATAATTACTATTTTAGTT-AGATATTTAATAGTAATATTGTTTTTC  Celaenorrhinus_leona        

Alenia_namaqua               ATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTTATCTTACTCTAATTGCTGTTAAATATTTGATTAGTTCTTTTCAATATATAGTCTTATATTAATTTAGGATGTATTTATACAGTTAATAAAGAACTAGTTCTCATGTATACATACGTACTTTTATTTTTTTGTCTCTAAATTTGTCTTGGAGGATATTTAATCTTATCTGATTAACTTAAATCCTTATCTTTAATTATTTCTATATGTTATTACCTTA-CTTAATAGAGATAATATTTGATAGTATATCTTATATTATTTTTATTTTTATGTTAAAAAAAAAATATTGAAAAAATTAATCAACGGCCTGTTTATCCTTTAATAATCTTATTTATTTAATTTATTGCAAATTATACAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCGAATTTAAACTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTATTAATAATTACAATTTTAGTA-AGATATATAATATTAACTTTATTTTTC  Alenia_namaqua              

Eretis_plistonicus           ATTGGACTTTTAGGATTTATTGTTTGAGCTCACCATATATTTACTGATATATATTAATCTTTCTCTAATTGCAGTCCAATATTTGATTAGTTCCCATCAATATATAGCCTTATATTAAATTAGGGTGTATTTATACTGTAATTAAAGAATCAGCTCACTTGTATACTCTTGTACTTTTTTATTTCCGTCTCTAAATATGTTTTGGTGGTTATTTAACCCTATCAGATTAAATTAAATCCTTTTTATTAATTATTTCAATTAGATACTATTCTA-TTTAATAGAAATATCTTTTGATAGTATATCTTATATAATTATTATTCTTAATTTAAAATAAAAATATTGAATAAATTAACCAACGAATAACATACCCCTTAATAACCTTATTTACTTAATCTTCTGCAAATCATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAAC-ATGGCAACTTGATCAAATTTAAATTTACAAAATGGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTATTAATAATTACTATTTTAGTA-AGTTATTTAATAATTATATTATTTTTT  Eretis_plistonicus          

Sarangesa_bouvieri           ATTGGATTATTAGGTTTTATTGTATGAGCTCACCACATATTTACAATAATATATCCATTCCACCCTAATTGCTGTAAAATATTTGATTAGATCTTTTCAATATATAGTCTTATATTAAATTAGGATGTATTTACACAGTAGATATAGAATTAGTTCACCTGTATACCTATGTACTTTTATGATTCTGTCGCTAGGTATGATTTGGGGGATATCTAATCCCACCAGATTAACTTAAATCCCTTTTACTAACTATTTCTACTAGATACTACCCTA-TTCAATAGTGATAACTTTTGATAGAATATCACATACATTTATTATTTCTACTTTAAAAAAAAAATACTGAAAAAATTAACCAACGAATTGCCCATCCATTAATAATCCTATTCATTCAATTTAAAGCTAATTATATAACGCCATTAGAAA------------------------TTTCTAATATGGCAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCTACATGATCTAATTTAAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCACGATCACACTTTAGTTATCCTATTAATAATTACTATTTTAGTT-TCTTACATTATAATTATACTATTTTTT  Sarangesa_bouvieri          

Pseudocoladenia_dan          ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGATATATATTTATTCTACACTAATTGCTGTAAATTATTTGATTAGTTCTTAACAATATATAGACATATATTAAATTAGGATGTATTTATACAGTTGATAAAGAATTAGTTCTCATGTATACTTATGTACTTTTATAATTTTGTCTCTAAATATGTTTTGGAGGTTATTTAATCTTATCAGTCTTAATCTAATCCTTATTTATAATTATTTCTATTAGGTTTTAATCTA-TTTATTAGAAATAATTTTTGATAGTATATCTTATATATTTATTATTATTATTTTAAAAAAAAAATATTGAATAATTAAATCAACGAATTATTTATCCTTTAATAATCATATTTATTTAATATATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGTGCTTCCCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACATTAGTAATTTTATTAATAATTACTATTTTAGTT-AGTTATTTAATAATTATATTATTTTTT  Pseudocoladenia_dan         

Celaenorrhinus_eligius       ATTGGTCTTTTAGGATTTATTGTATGAGCACATCATATATTTACTGAAATACATTTATTTTACTCTAATTGCTGTAAAATATTTGATTAGAATATTTCAATATATAGCCTAATATTAAATTAGGATGTATTCTTACTGTAATTAAAGAATTAGTTCCCTTGTACACTCTTGTACATCTATATTTTTGTTACCAAATATGTTTTGGAGGATATTTAACCTTATCAGATTAACTTAAATTCTTATTATCAATTATTTCAATTAGGTTTTATTTTA-TCTAATAGGGATATTTTTTGACAGTTTATCATACATTATTATTATTTTTATATAAAAATAATTATATTGAAAAAATTAATCAACGAATAACATACCCTCTCATAAGCATTTTTATTAAATTTAATGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGACCATACTTTAGTTATTTTATTAATAATTACTATTTTAGTT-AGTTATTTAATAATATCTTTATTTTTT  Celaenorrhinus_eligius      

Gorgythion_begga             ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTCTCTCAAATTGCAGTTATATATTTGATTAGATCTTAACAATATATAGACTTATATTAAATTAGGATGTATTTATACTGTTAATAGAGAATTAGATCACTTGTATACTTATGTACTTTTTTATTTTTGTTACTAAACATGTTTTGGAGGATATCTAATCTTATCAGATTAACTTAAATCCATTTTTATAATTATCTCAATTTGTTTTTATTTTA-TTCATTAGTTATAACATTTGATAGTACATCATATATTTTTATAATTATTATATTAAAAAAAAAATGTTGAATAAATTAATCAACGAATTGTTTATCCTCTTATAAACTTATTTATATAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATATTAGTT-AGATATTTAATAATTTCATTATTTTTT  Gorgythion_begga            

Theagenes_dichrous           --------------------------------------ATTTACAGTAATATATTTATTTCTCACTAATTGCTGTCTTATATTTGATTAGACTATTTCAATATATAGTCTAATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACATGCATACTCTTGTACTTTTTTACTTTTGTTACAAAATATGTTTTGGAGGATATTTAATCTTATCAGACTTACTTAAATCCATTTTTATAATTATTTCTATTAGTTATTATTTTA-TTTAATAGAAATAATTTTTGATACTATATCATATATTTTTATTATTATTATATAAAAATAAAAATATTGAACAAATTAATCAACGAATCATTTATCCTCTTATAAACTTATTTATATAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCCTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTAT---------------------------------  Theagenes_dichrous          

Timochares_trifasciata       ATTGGACTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTTACTTCTCACAAATTGCAGTGTTTTATTTGATTAGTACATATCAATATACAGTCTAATATTAAATTAGGATGTATTTATACTGTAGATAAAGAATTAGTTCTCTTGTATACTCTTGTACTTTTTTTCTTTTGTTACTAAGTATGTTTTGGGGGATATTTAATCATATCAGACTTACTCTAATCCTTATTTATAATTATTTCTATTAGTTATTATTTTA-TTTAATAGTTATAATTTCAGATAGAATATCATATACCTTTATTATTTTTATATTAAATAAAAAATATTGAAAAAATTAATCAACGAATTATTTATTCACTTATAAACCTATCTATATAATCTTAAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCAAATTTAAATCTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATTTAATAATTTCTTTATTTTTT  Timochares_trifasciata      

Camptopleura_auxo            ATTGGATTATTAGGATTTATTGTTTGAGCCCATCATATATTTACTGTTATATATTAATCTTTCACAAATTGCAGTATATTATTTGATTAGATCTTATCAATATATAGTCTAATACTAAACTTGGATGTATTTATACTGTAAATATAGAACTAGTCCACTTGTATACACATGTACTTTTTTATTTTTGTTACAAAATATGTTTTGGAGGATATCTAATCTTATCTGCCTTACTTAAATCCATATTTTTAATTTTATCTATTAGATTTTATCTCA-TTTAATAGTTATAATTTCCGATAGAACATCATACATTTTTGTTATTTTTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATCTACCCTCTTATAAACTTATTTATATAACTTAACGCTAGTAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTAAATTTACAAAATAGAGCCTCCCCCTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGATATTTAATAATTTCTCTATTTTTT  Camptopleura_auxo           

Helias_phalaenoides          -------------------TTGTTTGAGCCCATCATATATTTACTGTTATATATTAAATTTACACTAATTGCTGTTCATTATTTGATTAGATCTTAACAATATATAGTCTAATATTAAATTAGGATGTATTTATACTGTTAATATAGAATTAGCTCACCTGTATACTTATGTACTTTTTTTTTTTTGTTACTAAATATGTTTTGGAGGTTATTCAACCTTATCTGTCTCACTTAAATCCATATTTATAATTATTTCTATTAGTTTTCAATCTA-TTTAATAGTTATAACTTTTGATAGTATATCATATATTTTTATTATTTTTATATAAAAAAAAAAATATTGAGAAAATTAACCAACGAATTATTCTTCCTCTTATAAACTTATTTATATAATCTATTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACAGTATTAGTT-AGTTATTTAATAAT-----------TT  Helias_phalaenoides         

Ebrietas_anacreon            ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAATATATTTATTTTACACTAATTGCTGTGTATTATTTGATTAGATCTCAACAATATATAGACTTATATTAAATTAGGGTGTATTTATACAGTTAACAAAGAACTAGATCACTTGTATACTTATGTACTCTTTTACCTTTGTCACAAAATATGATTTGGAGGATATCCAATCTCATCAGTTTAACTCTAATCCATATTTATAATTATTTCCATTAGATTCTATTCTA-CTTAATAGTTATAATTTTTGATAGTATATCATATATCATTTTTATTTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTCCTCCCCTTATAATCTTATTTATATAATCTTTTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATTTAAATTTACAAAATAGAGCCTCACCTTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGATACTTAATAATATCTTTATTTTTT  Ebrietas_anacreon           

Ebrietas_infanda             ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTTATATATTTATCTCTCTCTAATTGCAGTTTATTATTTGATTAGATCTTTCCAATATATAGACTTATATTAAATTAGGGTGTATTTACACTGTTAATAAAGAATTAGTCCACTTGTATACTTATGTACATTTTTATTTTTGTTACTAAGTATGCTTTGGTGGATATTCAATCTTATCTGTTTAACTTAAATCCTTATTTATAATTATTACTATTAGTTTTTACTTCA-TTTATCAGTAAAAACATCTGATAGAATATCATATATTTTTATTATTTTTATATAAAAAAAAAAATACTGAAAAAATTAATCAACGAATTATTTATTCTCTTATAATCTTATTTATATAATTTTCAGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATCTACAAAATAGAGCTTCACCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATTTAATAATTTCCTTATTTTTT  Ebrietas_infanda            

Sostrata_bifasciata          ATTGGATTATTAGGATTTATTGTTTGAGCACATCATATATTTACAGAAATACATTTATTTCTCTCTAATTGCTGTATAATATTTGATTAGATCTCAACAATACATAGACTTATATTAATTTAGGGTGTATTTATACAGTAAATAAAGAATTAGTTCTCTTGTATACTTATGTACTTTTGTAACTTTGTCTCCAAAAACGATTTGGGGGATATTTAATCATATCAGACTTACATAAACCCATTTTTATAATTATTTCTATTTGGTATTAATTCA-TTTAATAGTAATAATTTTTGATAGTATATCACATATTATTATTATTATTATATTAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATCCTCTTATAAAATTATCTATATAATTTAAAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAACTTAAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATTTAATAATTTCTTTATTTTTT  Sostrata_bifasciata         

Mylon_pelopidas              ATTGGATTGTTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATACATTTATTTTTCACTAATTGCAGTTAAATATTTGACTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATTTACACAGTAAATAAAGAATTAGATCTCTTGTATACTTATGTACTTTTTTAATTTTGTCTCTAAATATGATTTGGAGGATATTTAATCATATCAGACTTACATAAATCCATTTTTATAATTATCTCTATTTGATTTTAATTTA-TTTATTAGAAATATTATTTGATAGTATATCTTATACCTTTTTTATTTTTATATAAAAAAAAAAATATTGAAATTATTAATCAACGAATTATTTATCCACTTATAAACTTTTATATATAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACAGTATTAGTT-AGTTACTTAATAATTTCTTTATTTTTT  Mylon_pelopidas             

Gesta_invisus                ATTGGATTATTAGGATTTATTGTATGAGCCCATCATATATTTACTGAAATATATTAACTTTTCACTAATTGCAGTATATTATTTGATTAGTTCTTTTCAATATATAGACTTATATTAAATTAGGATGTATTTATACAGTAGATAAAGAATTAGTTCTCTTGTATACTCTTGTACATTTATAATTCTGTTACTAAATATGTCTTGGGGGATATTTAATCTTATCCGACTAACTTAAACCCATTCTTATAATTATCTCAATTTGTTTTTATTTCA-TTTAATAGAAATTATATTTGATAGTATATCATATACTTTTATTATTATTATATAAAAAAAAAAATATTGAATAAATTAACCAACGAATTATTTACCCATTAATAAACTTATTTATATAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGCGCTTCACCTTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACCGTATTAGTT-AGTTATATAATAATTTCCTTATTTTTT  Gesta_invisus               

Erynnis_horatius             ATTGGATTATTAGGCTTTATTGTATGAGCCCATCATATATTTACTGAAATATATTAATTCTTCACTAATTGCAGTTTAATATTCGATTAGTTCTCTTCAATATATAGACTTATATTAAATTAGGATGTATTTATACAGTAAATATAGAATTAGTTCTCTTGTATACTCTTGTACATTTGCATTTCTGCCTCTAAAAATGTTTTGGGGGATATTCAATCTTATCTGTCTTACTTAAACCCATTTATATAATTATCTCAATTTGGGTATACTTCC-TTTAATAGAAATAATTTTTGATAGCATATCATATATTTTTATTATTACTATATAAAAAAAAAAATATTGAATAAATTAACCAACGAATTATCTATCCATTAATAAACATATTTATATAATCTATAGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAACAGTGCTTCACCTTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATTTAATAATTTCTTTATTTTTT  Erynnis_horatius            

Erynnis_afranius             ATTGGATTATTAGGATTTATTGTATGAGCACATCATATATTTACCGAAATATATTAATTTCTCACTAATTGCAGTATAATACTTGATTAGTTCTCTTCAATATATAGACTAATATTAAATTAGGATGTGTCTATACAGTAAATAAAGAATTAGTCCTCTTGCACACTCCCGTACATTTATACTTTTGTTACCAAAAATGTTTTGGGGGATATTTAATCTTATCTGACTTACTTAAATCCATTTATGTAATTATTTCAATTTGATTCTACTTAA-TTTAATAGAAACAATTTCTGATAGTATATCATATATTATTATTACTATTATATAAAAAAAAAAATATTGAATAAATTAACCAACGAATTATTTATCCATTAATAGACTTATTTATATAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---CTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGTGCTTCACCTTTAATAGAACAAATTATCTTTTTTCATGATCATACATTAATTATTCTAATTATAATTACTGTATTAGTT-AGTTATTTAATAATTTCTTTATTTTTT  Erynnis_afranius            

Antigonus_erosus             ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTACTTAACCCAAATTGCTGTAATTTATTAGATTAGACTATTTCAATATATAGTCTTATATTAACCTAGGATGTATTTATACTGTATATATAGAATTAGTTCACATGTATACTTATGTACATTTATATTTTTGTCTCTAAATATGTTTTGGAGGATATTTAATCATATCAGACTTACATAAATCCATTTCTCTAATTATTTCAATTAGATTCTACTCTA-TTTAATAGAAATAATTTTTGATAGAATATCTTATATAATTATTATTTTTATATTAAAAAAAAAATATTGAAATTATTAATCAACGAATTATTTATCCTCTTATAATCATTTTTATTTAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTCTAATAGAACAAATTATTTTTTTCCATGATCACACCTTAATTATTTTACTAATAATTACAATTTTAGTA-AGTTATATAATAATTTCATTATTTTTT  Antigonus_erosus            

Systasea_zampa               ATTGGATTATTAGGATTTATTGTTTGAGCCCACCATATATTTACTGATATATATTATATTAACTCAAATTGCAGTATTATATTTGATTAGAATATATCAATATATAGACTTATATTAAACTAGGATGTATTTATACTGTAAATAATGAATTAGTTCTCATGTATACTCTTGTACTTTTATTTTTTTGTCTCTAAATTTGTTTTGGAGGATATTCAATCTCGTCAGACTTACTCAAATCCTTTCCTCTAACTATTTCCATTAGTTATTATTTTA-TCTAATAGAAAAAATATTTGATAGTATATCTTATATTTTTTTTATTAATAATTAAAAAAAAAAATATTGAATTTATTAATCAACGAATTATTTATCCTCTAATAATCTTTTCTATTTAATTTATTGCTAATCATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAAGATGATCTAACTTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTGTATTAGTA-AGTTATATAATAATTTCTTTATTTTTT  Systasea_zampa              

Zopyrion_sandace             ATTGGATTATTAGGTTTCATTGTTTGAGCACATCATATATTTACAGAAATATATTTCTTTAACTCTAATTGCAGTAATTTATTAGATTAGATTATATCAATATATAGAGTTATATTAATTTAGGATGTATTTATACTGTAATTAAAGAAATAGTTCACATGTATACTCATGCACTTTTATTCTTTTGCCTCTAAATTTGTTTTGGGGGATATTTAACCATGTCTGACTTATATAAACCCATATTTACTATTATTTCTACTAGATATTATTCTA-TTTAATAGACATAATATTTGATAGCATATCTTATATTATTATAACCCTTATATTAAAAAAAAAATATTGAATTTATTAATCAACGAATTATTTATCCATTAATAATCATTTTTATTCAATCTTTCGCTAATAATATAATACCCTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACGGTATTAGTT-AGTTATATAATAATTTCTTTATTTTTT  Zopyrion_sandace            

Pyrgus_ruralis               ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTTATTTAACTCTAATTGCAGTTCTATATTAGATTGGATTATATCAATATATAGACTTATATTAAACTAGGATGTATTTATACTGTTATTATAGAATTAGTTCACTTGTATATCTATGCACTTTTATTTTTTTGTTACTAAATATGTTTTGGAGGTTATCTAATCCTATCTGATTAATATAAATCCATTTTTATAATTATCTCTATTAGATTTTATCTTA-TTTAATAGTAAAAATATTAGATAGTATATCTTATATATTCATTATTATTATATTAAAATAAAAATATTGAAATTGTAAATCAACGAATTATTTATCCTTTAATAATCATCTTTATTCAACTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGTGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATATAATAATTTCATTATTTTTT  Pyrgus_ruralis              

Pyrgus_scriptura             ATTGGATTATTAGGATTTATTGTATGAGCTCATCACATATTTACTGAAATATATTATTTTCACTCTAATTGCAGTTTTATATTAGATTAGATTATATCAATATACAGACTTATACTGAATTAGGATGTATTTATACTGTAACTATAGAATTAGTTCACTTGTATACATATGCACTTTTATTTCCTTGTTACTAAATATGTTTTGGAGGTTATCCAATCTTATCTGTTTAACATAAATCCATTTTTATAATTATTTCTATACGATATTATCTTA-TTTAATAGTAAAAATTTTAGATAGTATATCTTATATACTTATTATTTTTATATTAAAAAAAAAATATTGAAATCGTAAATCAACGAATTATTTATCCTCTTATAATCATTTTTATTAAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCCTCTCCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTATATAATAATTTCATTATTTTTT  Pyrgus_scriptura            

Pyrgus_communis              ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTTTCTTAACTCTAATTGCAGTTTTATATCAGATTAGAATATAACAATATATAGACTTATATTAAATTAGGATGTATTTATACTGTAAATATAGAATTAGTTCACTTGTATACATATGTACTTTTATTATTTTGTTACTAAATATGTTTTGGAGGATATTTAATCTCATCTGTCTTACAAAAACCCATTTTTATAATTATTTCCATTAGATATTACTTTA-TCTAATAGTAATAATATTTGATAGAATATCTTATATCATTATAATTATTATATTAAAAATAAAATATTGAAATTATTAATCAACGAATTATTTATCCTCTTATAATCATTTTTATTTAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATAGAGCCTCTCCATTAATAGAACAAATTATCTTCTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTGTATTAGTT-AGTTATATAATAATTTCATTATTTTTT  Pyrgus_communis             

Heliopetes_alana             ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTGTTTTAACTCTAATTGCAGTTATATATTCGATTAGTTTATATCAATATATAGTCTTATATTAAATTAGGACGTATTCATACAGTAAATATAGAATTAGTTCACCTGTATACTTATGCACTTTTTTAATTTTGTTACTAAAAATGTTTTGGAGGATATCCAATCTTATCTGTTTAATAAAAATCCATTTTTATAATTATTTCCATTAGATATTATTCTA-CTTACTAGATATTTCATTTGATAGTATATCTTATATTCTTATTATTTTTATATTAAAAAAAAAATATTGATATTATTAATCAACGAATTATTTATCCTTTTATAATCATTTCTATTCAACTTACAGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAACTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTC-AGATATATAATAATCTCATTATTTTTT  Heliopetes_alana            

Celotes_nessus               ATTGGATTATTAGGTTTTATTGTATGAGCACACCATATATTTACAGTTATATATTATTTCTACACTAATTGCAGTATAATACCTGATTAGAATATATCAATATATAGTCCAATATTAAACTAGGATGTATTTGTACTGTAAATAAAGAATTAGTTCACATGTATACATATGTACATTTATTACTTTGACCCTAAATATGTTTTGGAGGATATTTAATCTTATCTGATTAACATAAACCCATTCTTATAATTATTTCTATATGATTTCAATTCA-TTTAATAGAAATAATATTAGATAGTATATCATATATATTTATTATATTTATTTTAAAAAAAAAATATTGAAATTATTAATCAACGAATTATTTATTCACTTATAACCATTTTTATTCAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAACCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACAATATTGGTA-AGTTATATAATAATTTCTTTATTTTTT  Celotes_nessus              

Eracon_lachesis              ---------TTAGGATTTATTGTTTGAGCTCATCATATATTTACCGAAATATATTCATTTCACTCTGATTGCCGTAAAATACTTGATTAGTTTATACCAACATATAGTCCTATATTAAATTAGGGTGTATTTATACTGTTGATAATGTGATAGTCCACTTGTATACTTATGCACTTTTTTTCTTCTGTCCCTAAAATTGTTTTGGAGGATATTTAATCACACCAGACTAACTCAGACCCTCTTCTATAATTATTTTAATCAGGTTTTACCCAA-TCCAATAGTAATATTTTTAGATAGAATATCTTATACATTAATTATTTCTATATAAAACAAAAGATACTGAATAAATTTATCAACGAATTATTTACCCCCTTATAAGCTTATTCATTCAATCTACCGCTAATAACATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATCTCCAAGATGGAGCTTCGCCCCTAATAGAACAAATCATTTTCTTTCACGACCATACACTAATTATTTTAATTATAATTACTGTATTAGTT-AGTTACATAATAA--------------  Eracon_lachesis             

Clito_aberrans               --------------------------------------------TGAAATATATTTATTCTACTCTAATTGCAGTTTAATATCTGATTAGATCCCACCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTTAATATAGAACTAGTTCTCTTGTATACTTATGCACATTTATACCTTTGTTACTAAAAATGTTTCGGAGGATATTCAATCTTATCAGATTAACTTAAATCCATACTTATAATCATTACTACTCGATTTTAATTTA-TCTATCTGAAATATTTTTTGATAGTATCTCTTATATTCTTTTTATTATTATATTAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATCCCCTTATAAACATTTATATATAATCTCTAGCAAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTACAAAATAGAGCATCCCCCTTAATAGAACAAATTATTTTTTTTCACGATCATACTCTAATTATTTTAATTATAATTACTATTTTAG------------------------------  Clito_aberrans              

Quadrus_cerialis             -------------------TTGTATGAGCACATCATATATTTACAGAAATATATTTATTTTTCACTAATTGCTGTATAATATTAGATTAGACCTCAACAATATTTAGACTTATATTAATTTAGGATGTTTTTATACAGTCAATAAAGAATTAGATCACATGTATACTCTTGTACTTTTATTTTTTCGTTACTAAATATGTTTTGGGGGATATTTAATCTTATCAGATTAACTTAAATCCATTTATATAATTATTTCAATTAGATTTTATTTCA-TTTAATAGAAATATTATTTGATAGTACATCATATACTATTATTATTTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTACCCCCTTCTAATCTTTTTTATTAAATTTACAGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGA-TATATGTAATGGATTTAAACCCCATTTATAAAGGA---TCA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATTAATTTACAAGATAGAGCATCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-ACTTACTTAATAATTTCAT--------  Quadrus_cerialis            

Pythonides_jovianus          -------------------TTGTATGAGCTCATCATATATTTACAGAGATGTATTTATTCTACTCTAATTGCCGTATATTATTTGATTAGTTCTTATCAATATATAGACTTATATTAAATTAGGATGTTTCTATACAGTAAATAATGAATTAGATGTGTTGTATACTTATGTACTTTATTATTTTTGTTACTAAATTTGCTTTGGAGGATATCTGACCCCATCAGTTTAACATAAACCCATTTTTACTATTATTTCTACTAGATTTTATTCTA-TCCATTAGTTATTTTATTAGATAGTATATCCTATACAATTATTATTATTATATAAAAATAAAAATATTGAATAAATTAATCAACGAATTATTTACCCCCTTCTAATCTTCTTTATTAAATTTAAAGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCATCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTGTATTAGTT-AGATATTTAATAATTTCAT--------  Pythonides_jovianus         

Milanion_marciana            ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAGATATATTTGTCTAACTCTAATTGCAGTATAATATTTGATTAGAACATACCAACATATAGACTAATGTTAATCTAGGATGTATTTATACTGTTAATAAAGTATCAGTTCCCATGTATACCCTTGTACATTTATATTTTTGTTACAAAATATGTCTCGGAGGATATTTAATCACTTCAGTCTTAATTAAATCCATTCTTATAATCATTTCAATATGTTATTATCTCA-TTTATTAGTAACATCCTTTGACAGAATATCTTATATAATTGTTATTATTACTTAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTGTTTACCCATTAATAATCATCTTTATTCAATTTACAGCTAATTATATAATACCATTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCATCACCTTTAATAGAACAAATTATCTTCTTCCATGATCACACATTAATTATTTTAATTATAATTACTATTTTAGTA-AGTTATTTAATAATTTCACTATTTTGA  Milanion_marciana           

Atarnes_sallei               ATTGGATTATTAGGATTTATTGTATGAGCTCATCACATATTCACTGAAATATATTTATTTAACTCTAATTGCAATTTAATATTTGATTAGAACATTTCAATACATAGACTTATGTTGACCTAGGGTGTGTTTATACTGTATTCTAAGTATTAGTTCCCTTGTATACACTTGTACATTTATAACCTCGTCACCAAATATGTTTTGGAGGATATTTAATCACTTCAGTCTTAGATAAACCCATTCTTACAACTATTTCAATATGATATCATTCAA-TTTAATAGTTGTTCTATCAGATAGTATATCTTATACAATTATTATCATTATTTAAAAAAAAAAATATTGAAAAGATTAATCAACGAATTATTTACTCAATAATAATCATTTCTATTTGCTTTACAGCTAACAATATAATACCATTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAGTGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATCGCAACATGATCTAATCTTAATCTTCAAAATAGAGCATCTCCATTAATAGAACAAATTATCTTTTTCCACGATCATACATTGATCATTTTAATTATAATTACTATTTTAGTT-AGTTATTTAATAATCTCATTATTTTGA  Atarnes_sallei              

Achlyodes_busirus            ATTGGATTATTAGGTTTTATTGTATGAGCACATCATATATTTACTGTTATATATTAAATTTACTCTAATTGCTGTTTATTATTTGATTAGATTATAACAACACATAGTCTTATATTAAATTAGGATGTATTTATACAGTAAACAAAGTATCAGTTCCCTTGTATACATATGTACTTTTTTAATTCCGTCTCTAAGTATGCTTTGGGGGATATTTAATCTTATCAGACTTACTTAAATAATTATCTTCTACTTTATCAATTAGATATTATTTCA-TTTATTAGGAATTTTATTAGATAGTATACCATATAATTTTATTATTTTTATATTAAAAAAAAAATATTGAAAAAATTTATCAACGAATTATTTATCCTCTTATAATCATATTTATTTAATTTACAGCTAATAATATAATACCCTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGTATATTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAACTTTAATTTACAAAACAGTGCCTCCCCTCTTATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-TCATATATAATAATTTCTTTATTTTTT  Achlyodes_busirus           

Aethilla_lavochrea           ATTGGATTATTGGGATTTATTGTATGAGCCCATCATATATTTACCGAAATACATTTAATTTACTCAAATTGCTGTTCATTATCAGATTAGATCCCAACAATATATAGTCTAATATTAAATTAGGATGTATTTATACAGTAGATAATGAATTAGCTCTCTTGTATACTTATGTACTTTTTTATTTTTGTCTCTAGATATGATTTGGGGGATATTCAATCACATCAGATTAACACCAATTCTTATTTATAATTATTTCCATTAGGTATTACTTAA-TTCAATAGAAATTATACTCGATAGAATATCATATATTTTTATTATTTTTATATAAAAAAAAAAATACTGAGAAGATTTATCAACGAATCATTTATCCTCTTATAACCATTTTTATTCAATCTTAAGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGTAATATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATCATAATTACTATTTTAGTA-TCTTATATAATAATTTCATTATTTTTT  Aethilla_lavochrea          

Cyclosemia_anastomosis       ATTGGTTTATTAGGTTTTATTGTATGAGCTCATCATATATTTACTGAAATATATTTATTTTTCTCTAATTGCAGTAATATATCTGATTAGTTCTTTACAATATATTCACTCATATTAAATTAGGGTGTATTTATACAGTTGATAAAGAATTAGTTCTCATGTATACTTATGTACTTTTTTATTTTTGTCACTAGATATGTCTTGGGGGATATTTAACCATATCAGATTAACTTTAACCCTTATTTATAATTATCTCCATTAGATATTATTCTA-TTTATTAGTCATAACTTTTGATAGTATATCATATATTTTTTTTATTTTTAAATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCATTTATAGCCTTATATATTTAATCTTTAGCAAATAATATAATACCCTTAGCAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATTTAAATTTACAAAATAGCGCGTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCACACATTAATTATTTTAATTATAATTACTATTTTAGTA-ACATATATAATAATTTCTTTATTTTTT  Cyclosemia_anastomosis      

Pachyneuria_lineatopunctata  -----------------------------TCATCATATATTTACAGATATATATTTTTTTAACTCTAATTGCAATCAATTATCTGATTAGTTTATATCAATTGATACTCTTATACTTAATTAGGATGTATTTATACAGTAGATATAGAATTAGATCTCTTGTACACATATGTAGTTTTTTTTTTTTGTTACTAAATATGTTTTGGAGGATATTTAATCTTATCAGATTAATAAAAATCCTTTTTTATAATTATTACTATTAGATATTATTCTA-TCTATTAGAAATTTTACTTGTATCTATATCATACATTTTTATTATTACTATATAAAATAAAAAATATTGAATAAATTAATAAACGAATTATTCATCCACTTATAATCTTATTTATTAAATCTATCCAAAATTACATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAACCTTAATCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTCCACGATCATACTTTAATTATTTTAATTATAATTACCATATTAGTT-AGTTA----------------------  Pachyneuria_lineatopunctata 

Viola_minor                  ------------GGATTTATTGTATGAGCTCATCATATATTTACTGTTATATATTTTTTTAACTCCAATCGCTGTAAAATATTTGATTAGTTTATTTCAATTTATACTCTTATACTTAATTAGGATGTATTTATACTGTAAATATAGAATTAGATCCCTCGTATACTTATGTACTTTTTTTTTTTTGTCACAAAGTATGTTTTGGGGGATATTTAACCATATCAGTTTAACTTAAACCCTTACTGATAATTATCTCTATTAGATATTATTCTA-TTTACTAGTAACTTCACTTGATAATATATCATATATTTTATTTATTATTATATAAAAATAAAATTATTGAAAAAATTAATAAACGAATTATTATCCCATTAATAATCTTATTTATTAAACTTATGGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCCAATATTAATTTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATATTTTAATTATCCTAATTATAATTACTATTTTAGTT-AGATACATAAT----------------  Viola_minor                 

Staphylus_ceos               ATTGGTCTTTTAGGATTTATTGTTTGAGCTCATCATATATTCACAGATATATATTTACTTTACACTAATTGCAGTAAATTATTTGATTAGACTATAACAATTTATTCCCTTATACTAACTTAGGATGTATTTATACAGTAGATATAGAATTAGATCCCTTGTACACTTATGTACTTTTCTACCTCTGGTACTAAGCATGTTTTGGGGGATATCTAATCTTATCAGATTAACAAAAATCCTTTTTTATAATTATCTCAATTAGATTTTATTCCA-TTCTATAGTTATAACATTTGATAGTACATCTTATACCTTCATAATACCTTCATAAAAATAAAATTATTGAATAAATTAACCAACGAATTATTCACCCATTAATAATCATATTCATTCAATTTATTGCTAATAATATAATACCTTAAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCCTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATATTAGTT-AGTTATATAATAATTTCTTTATTTTTT  Staphylus_ceos              

Pholisora_catullus           ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTCATTTTCCTCTAATTGCAGTATTATATTTGATTAGTTTATAACAATTTATTCACTTATACTTAATTAGGATGTATTTATACTGTAGATGAAGAATTAGTTCTCTTGTATACTTATGTACTTTTTTATCTTTGTTACTAATTATGATTTGGGGGATATTTAATCTTATCAGATTAACTAAAATCCTTATTTATAATTATCTCTATTAGAGTTTATTCCA-TCTAATAGCAATATTTTTGGATAGTATATCATATATCATCATTATTATTATTTAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCATTAATAATCATATTTATTCAATTTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGG---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACAATATTGGTA-AGTTATATAATAATTTCTTTATTTTTT  Pholisora_catullus          

Carcharodus_alceae           ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTTAATTCTCTCTAATTGCTGTAATATATTTGACTAGTTCTTACCAACACATTCTCTTATACTTATTTAGGATGTATTTATACAGTAGGTAAAGAATTAGTTCTCTTGTATACATATGTACTTTTATATTTTTGTTACTAAATTTGTTTTGGAGGATATTTAACCTTACCTGACTAATATAAACCCTTTTATATAACTATTTCTATTAGATTTTACTCTA-TCTAATAGACATAATTTTTGATAGATTATCATATATATTTTTTATTTTTATATTAAAAAAATAATATTGAAAAAATTAACCAACGAATTATTTATTCATTTATAATCTTTTTTATTAAATCTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--GTGGCAACATGATCTAACTTTAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTCCATGATCATACTTTAATTATTTTAATTATAATCACCATATTAGTA-AGATATATAATAATTTCATTATTTTTT  Carcharodus_alceae          

Spialia_sertorius            ------------GGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTTTATTTACTCTAATTGCTGTAATATATCTGATTAGTCCTTATCAAATTATTCTCTAATACTTAATTAGGATGTATTTATACTGTAGATAGAGAATTAGATCTCTTGTATAGTCTCGTACCTTTTTACTTTTGCTACAAAATATGTTTTGGAGGATATTTAATCTCATCTGATTAATAAAAATCCTTACCTACAATTATCTCTATTAGTTATTACCTAA-TTTAGCAGTGATATCTCTTGATAGAATATCTTATATATTTTTCATTTCTATATTAAAATAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCATTTATAACCTTATTTATTTAATTTAAAGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGAGCTAATCTTAATTTACAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTCCACGATCATACCTTAATTATTCTAATCATAATTACTATATTAGTT-A--------------------------  Spialia_sertorius           

Carterocephalus_palaemon     ATTGGATTATTAGGATTTATTGTTTGAGCTCATCACATATTTACAGAAATATATTTATTTTTCTCTAATTGCAGTAAAATATCAGATTAGACCTTAACAACATATAGTCATATATTAATTTAGGATGTATTCATACTGTAAATAAAGAATTAGTTCTCATGTATACTTATGTACTTTTGTATTTTTGACTCTAAATATGTTTTGGAGGATATTTAATCTTATCAGACTAACTAAAACCCCTATTTATAATTATCTCAATTAGATTCTATTCCA-TTTAATAGTAATAATTTTTGATAGAATATCATATATATTCGTTATTCCTATATAAAAAAAAAATTATTGAATAAATTAACCAACGAATTGTATATCCCTTAATAAGCATTTTTATTCAATTTATTGCTAATCATATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGA---GTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATCATTTTTTTTCACGATCACACTTTAATTATTTTATTAATAATTACTATTTTAGTT-AGTTATTTAATAATAAGATTATTTTTT  Carterocephalus_palaemon    

Metisella_metis              ATTGGGTTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTTATTTTTCTCAAATTGCAGTTTTATATTAGATTAGATCTTTTCAATATATAGTCTCATATTAAATTAGGATGTATTTATACTGTTGATAAAGAATTAGTCCTCATGTATACCTATGTACACTTATTTTTCCGATACAAAAAATGATTTGGGGGATATTTAACCTCATCTGACTAACTTAAATCCATATTTATAATTATTTCAATTCGATTTTATTCCA-TTTATTAGAAATAATTTTTGATAGCATATCATATATCTTTCTAATTTTTATATTAAAAAAAAATTATTGAATAAGTTAATCAACGAATTATTTATTCACTAATAAACTTTTCTATTCAATCTCTAGCAAATTACATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTATTAATAATTACCGTTTTAGTA-AGTTATTTAATAATAAGATTATTTT--  Metisella_metis             

Piruna_aea                   ATTGGACTATTAGGATTTATTGTATGAGCCCATCATATATTTACAGAAATATATCTATTTCACTCTAATTGCAGTAAATTATTAGATTAGATCTTATCAATATATAGCCAATATCTAAATTAGGTCGTATCTATACAGTAAATATAGAATTAGTTCTCTTGTATACTCACGTACTTTTATATTTTTGTTACTAAAAATGTTTCGGAGGATATTTAATCTTATCAGATTAACCCTAATCCTTATTTACAATTATTTCTATTAGATATTATTCGA-TTTAATAGAAATAATATTTGATAGAATACCTTATATTATCATAATTTTTATATTAAAAAAAAAATATTGAATAAATTAACCAACGAATTATTTACCCATTAATAAACATTTTTATTCAATTTATAGCTAATTATATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATGGAGCTTCTCCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Piruna_aea                  

Dardarina_dardaris           ATTGGACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACAGATATATATTTTATTAACTCTAATTGCTGTTTAATATTAGATTAGATCTCAACAATATATAGTCATATATTAAATTAGGATGTATTTATACAGTAAATATTGAATTAGTTCTCTTGTATACATATGCACTTTTATTTTTTTGTTACAAAATATGTTTTGGAGGATATTTAACCATATGAGATTAACTCTAATCCTTATTTATAATTATTTCTATATGATATTATTCTA-TTTATTAGAAATAATTTTAGATAGAATATCTTATATTATTATTATTTTTATATTAAATAAAAAATATTGAATAAATTAATCAACGTATTATTTATCCATTAATAAGTAATTTTATTCAATTTATAGCTAATTATATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAACCTTCAAAATGCAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATCTTATTAATAATTACTATTTTAGTT-AGTTATTTAATAATAAGATTATTTTTT  Dardarina_dardaris          

Butleria_bissexguttatus      ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAGATACATTAATTTCTCACTAATTGCAGTAAAATATCTGATTAGATCTCATCAATATATAGTCTTATACTAAATTAGGATGTATTTATACAGTAAATAAAGAATTAGTCCTCTTGCATACTTGTCCACTTTTATACTTTTGTTACCAAATTTGTTTTGGGGGCTATCTAATCTTATCAGATTAACCCTAATTCATTTTTATAATTATTTCGATTAGATACTACCCAA-TTTAATAGAAATAATTCTTGATAGTATATCATATATTTTTATTATCATTACATTAAAAAAAAAATATTGAATAAATCAATCAACGAATTGTTTACCCTCTAACAAACATTTTTACTTAAATTAGCGCAAATCATATAATACCTTTACAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTCCATGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATTTAATATTAAGATTATTTTTT  Butleria_bissexguttatus     

Antipoda_atralba             ATTGGACTTTTAGGATTTATTGTATGAGCACATCATATATTCACAGAAATATATTTTTTTTACACAAATTGCTGTTAAATGTTTGATTAGATCATATCAATACATAGACTTATATTAAATTAGGGTGTTTTTACACAGTAAATATAGAATTAGATCACTCGTATACATATGTACTTTTTTATTTTTGTTACTAAATTTGTTTTGGAGGTTATTTAACCATATCTGTTTAACCTTAACCCATTTTTATAATTATCTCAATTTGATATTATTCTA-TTTAGTAGATATAATTTTTGACAGAATATCTTATATTTTTTATATTATTATTTAAAAAAAAAAATACTGAAAAAATTAATCAACGAATTGTTTATCCTTTAATAAACATTTTTACTTAATTTAATGCAAATAATATAATACCTTTACAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATTTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTA-AGTTATTTAATAATAAGATTATTTTTT  Antipoda_atralba            

Mesodina_aeluropis           ATTGGACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACTGATATATATTTTTCTTACTCAAATTGCTGTTAAATATTTGATTAGATTATAAAAATATATAGACTTATATTAAATTAGGATGTTATTATACAGTAAATAAAGAATTAGTTCCCATGTATACTTATGTACTTTTTTAATTTTGATACAAAATTTGTTTTGGAGGATATTCAATCATATCAGATTAACTCTAATCCATATTTATAATCATTTCAATTAGATTTTATTCTA-TTTAATAGTAATAACATTAGATAGAATACCACATATTTTTGTAATTCTTATATAAAAAAAAAAATACTGAAAAAATTAATCAACGAATTATTTACCCTTTAATAAACATTTTTACTTAACTTACTTCAAATAATATAATACCCTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTATA--TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAATCTACAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCACGACCATACTCTTATTATTTTAATTATAATTACTATTTTAGTA-AGTTATTTAATAATAAGTTTATTTTTT  Mesodina_aeluropis          

Oreisplanus_perornata        ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTATATATTTATTTTTCTCTAATCGCAGTAATATATTTGATTAGTCTATTACAATATATAGACTTATATTAAATTAGGGTGTTTTTATACTGTTAATAAAGAATTAGTTCTCATGTATACTTACGTACTTTTTTAATTTTGATACTAAATATGTTTTGGGGGATATTTAACCATATCTGACTAACCCTAATCCTTATTTCCAATTATCTCTATTAGATTTTATTCTA-TTTATTAGTTATAACTTTTGATAGTATATCTTATACTTTTATTATTTTTAATTAAAAAAAAATATATTGAATAAATTAACCAACGAATTATTTACCCTTTAATAATCATTTCTACTTAACTTATTGCAAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGGTCTAATTTTAATTTTCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGTTATATAATATTAAGATTATTTTTT  Oreisplanus_perornata       

Hesperilla_donnysa           ATTGGACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACAGAGATACACTTATTTTTCTCTAATTGCTGTATAATATTTGATTAGTTTACAACAATATATAGCCTTATATTAAATTAGGGTGTTTTTATACAGTAAATAAGGAATTAGTTCTCTTGCACACATACGTACTTTTTTATTTTTGATACTAAATATGTTTTGGGGGATATTCAACCATATCAGATTAACTCTAATCCATATTTATAATTATTTCTATTAGATTTTAATCAA-TTTATTAGATGTAATTTCTGATAGTATATCTTATATTTTTGTAATCTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTACCCTTTAATAATCCTTTTTACTTAATTTACTGCAAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGAT--TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATTTTAACTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAACTATAATTACTATTTTAGTG-AGATATATAATAATAAGATTATTTTTT  Hesperilla_donnysa          

Motasingha_trimaculata       ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTATTTTTACTCTAATTGCTGATTAATATTTGATTAGTCCTTATCAATATATAGACTTATATTAAATTAGGATGTTTTTATACAGTAAATACAGAATTAGTTCTCTTGTACACATATGTACTTTTTTACTTTTGATACTAAATATGTTTTGGAGGATATTTAACCATATCAGATTAATTAAAATCCTTATTTATAATTATTTCTATTAGATTTTATTTTA-TTTATTAGTAACTATTTTAGATAGTATATCTTATATCATTATTATTTTTACATAAAAAAAAAAATACTGAAAAAATTAATCAACGAATTATTTATCCTTTAATAATCTTTTTTACTTAATTTATTGCAAACTATATAATAGGTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATATATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATCTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAG------------------------------  Motasingha_trimaculata      

Signeta_flammeata            ATTGGACTTTTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGAAATACATTTTTTCTTCTCTAATTGCTGTTCAATATTTGATTAGTTTATATCAATATATAGTCTTATATTAAACTAGGATGTTTTTATACAGTAAATAAAGAATTAGTTCTCATGTATACCTATGTACTTTTTTAATTTTGTTACTAAATTTGTTTTGGAGGTTATTTAATCTTATCTGATTAACTCTAATCCATTTTTATAATTATCTCAATTAGATTTTATCTTA-TTTATTAGTAATAATTTTAGATAGAATATCTTATATTTTTATTATTTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTGTTTATCCTTTAATAAACTTCTTTACTTAATTATTTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGAATTTAAACCTCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAATTTTCAAGATAGAGCAACCCCATTAATAGAACAAATTACTTTTTTTCATGATCATACTTTAGTTATTTTAATTAGAATTACTATTTTAGTA-AGTTATTTAATAATAAGTTTATTTTTT  Signeta_flammeata           

Toxidia_peron                ATTGGACTTTTAGGGTTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTTTCTTACTCTAATTGCTGTTTAATATTAGATTAGTTTATATCAATATATAGACTTATAATAAATTAGGATGTATTTATACAGTAAATAAAGAATCAGTTCTCATGTATACTTATGTACTTTTTTATTTTTGTTACAAAATTTGTTTTGGAGGATATTTAATCTTATCAGACTAACCCTAATCCATTCTTATAACTATTTCAATTAGATTTTATTCTC-TTTAATAGTTATAATTTTAGATAGTATATCTTATATTTTTATTATTATTATATAAAAAAAAAAATATTGAAAAAATCAATCAACGAATTGTTTATCCCTTAACAAACTTTTTTACTTAACTATTTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTTAATTTTCAAGATAGAGCTTCCCCTTTAATAGAACAAATTACTTTTTTTCATGATCATACTTTAGTTATTCTAATTAGAATTACTATTTTAGTA-AGTTATTTAATAATAAGTTTATTTTTT  Toxidia_peron               

Toxidia_doubledayi           ATTGGATTATTAGGATTAATTGTATGAGCTCATCATATATTTACTGAAATATATTTATTTAACTCAAACTGCTGTTAAACATTTGGTGACTTCATATCAATATATAGTCTTATATGAAGTGAGGATGCTTTTATACTGTAAATAAAGAATCAGTCCTCTTGTGTACTTATGTACTTTTTTAATTTTGTCACAAAATTTGTTTTGGAGGATATTCAATCTTATCTGATTAACTTAAATCCTTATTTACAATTATCTCTACTAGAGTTTATTTTC-TTTATTAGTCATAATATTAGATAGCATATCTTATATTTTTATTATTTTTATATTAAAAAAAAAATATTGAATAAATCAATCAACGAATTGTTTATCCTTTAATAAACTTTTTTACTTAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAACTATAATTACTATTTTAGTT-AGATATTTAATATTAAGTTTATTTTTT  Toxidia_doubledayi          

Trapezites_symmomus          ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTTATTTTACTCTAATTGCTGTTAAATATTTGATTAGATTATATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTAAATAATGAATTAGTTCCCATGTATACTTGCGTACCTTTATAATTTTGATACTAAATCTGTTTTGGGGGATATTTAATCTCATCAGATTAACTCTAACCCTTATTTACAATTATTTCCATTAGATTTTATTCCA-TTTAATAGAAATAATTTTTGATAGTATATCTTATATTTTCATTATCTTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTGTTTACCCATTAATAAACATTTCTACTTAATTTACAGCGAATCATATAATACCTTTAGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------  Trapezites_symmomus         

Ampittia_dioscorides         ---------TTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTTACTCTCCTCTAATTGCTGTAAAATATTTGATTAGTTCTTATCAATATATAATCTTATACTAATTTAGGACGTATTTACACAGTAAATATAGAATTAGTTCTCATGTATACATATGTACTTTTTTAATCTTGTCACTAAATATGTTTTGGAGGGTATCCAACCTTATCAGACTAACATAAATCCTTATTTATAATTATCTCTATTAGTTACCATTCAA-TTTAGTAGAAACAACTTTTCATAGATTATCTTATATTTTTATTATTTTTATTTTAAAAAAAAAATATTGACTAAATTAATCAACGAATAATCCATCCTTTAATAATCATCTTTATTAAATTTATATCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCACATTATATGCTATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTTCAAAATGGAGCTTCTCCTCTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATA------------  Ampittia_dioscorides        

Sovia_albipectus             ------------GGATCTATTGTTTGAGCTCATCATATATTTACAGAAATATATTTATTTTACACTAATTGCAGTAATATATTTGATTAGTTCTTATCAATATATAGACTTATATTAAATTAGGATGTATCTATACTGTTAATATAGAATTAGTTCCCATGTATACACTTGCACTTTTATACCTTTGATACTAAATATGTTTTGGTGGATATTTAATCTCATCAAATTAACTCTAACCCCTATTTATAATTACTTCTATTAGATATTAATCTA-CTTAGTAGTAATAATCTTTGACAGATTATCTTATATATTCATTATTTTTATATTAAAAAAAAAATATTGATTAAATTAATCAACGAATTATTCATTCTTTAATAAACATTTTTATTCAATTTTCTGCTAATTATATAACACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAAT-ATGCCAACATGATCTAATTTTAACTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGTTTA------  Sovia_albipectus            

Halpe_porus                  -------------------TTGTTTGAGCTCATCATATGTTTACAGATATATATTTATTTTCCTCAAATTGCTGTTTAATATTCGATTAGATTATATCAATATATAGACTTATATTAAATTAGGATGTATTCATACAGTAAACATAGAATTAGTTCTCATGTATTCATATGTACTTTTATATCTCTGATACAAAACTTGTTTTGGGGGATGTTTAATCTTATCAGATTAATATAAACCCCTATCTATAATTATTTCAACTAGATATTACTCTA-TCTAATAGTGATAATTTTAGATAGATTATCTTATATTTTTATAATTTTTATTTAAAATAAAAAATATTAACAAAATTAACCAACAAATAATTTATTCTTTAATAATCTTTTATATTTAATTTATTGCTAATTATATAATACCTTTAGTAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAATTATTTTAATTATAATTACTATTTTAGTT-AGCTACATAATAATAACT---------  Halpe_porus                 

Thoressa_varia               ATTGGACTTTTAGGATTCATTGTTTGAGCTCATCATATATTTACAGATATATATTTAATTTTCTCTAATTGCGGTATTTTATTTGATTAGATCTTAACAATATATAGTCTCATATTAAATTAGGATGTATTTACACAGTAAATATAGAATTAGTTCTCTTGTATACCTATGTACATTTATACTTTTGTTACTAAATATGTTTTGGAGGATGTTTAACCTTATCTGTTTAACTTAAATCCTTATCTATAATTATTTCAATTAGATACTATCTCA-TCTATTAGTCATAACATTTGATAGTTTATCTTATACATTTATAATTTTTATTTTAAAAAAAAAATATTGATAAAATCAATCCACGAATAATTTATTCCTTACTAATCATATTCATTCAATCTGCTTCTAATTATATAACACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAGTGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAACCTTAATTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGTTATATATTAATAACATTATTTTTT  Thoressa_varia              

Suastus_minutus              ----------TAGGATTTATTGTATGAGCCCATCATATATTTACAGATATATATTGACTTAACTCTAATTGCCGTATATTATTAGATTAGTATACATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTAATTAGAGAACTAGTTCACTTGTATACTCTTGTTCTTTTATTTTTTTGTCTCAAATTATGTTTTGGGGGATATCTAATCTTACCTGATTAAATCTAATTCTTATTTTTAATTATTCTTATTTGATTTTATTTTA-TTTAGTAGTTATAACATTAGATAGTATCTCTTATATTTTTATAATCAGTAATTAAAAAAAAAACTATTGAATAAATTAATCAACGAATTGTTTATCCTTTAATAGCCATTTTTATTAAATTTACTGCAAATTATATAACACCTCTAGAAA------------------------TTTCTATTATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTACAA--ATAGCAACATGATCTAATCTTAATTTACAAAATAGAGCATCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-GGTTATATAATAATAAGA---------  Suastus_minutus             

Plastingia_naga              ATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGTAATATATTTAACTTTCTCTAATTGCTATTAAATATTTGATTAGATTATATCAATACATAGTCTTATATTAAATTAGGATGTATTTATACAGTATTTAAAGAATTAGTTCACTCGTATACTCTTGTTCATTTTTATTTTTGTTACTAAATATGTTTTGGAGGATATTTAACCCTATCAGATTAAATAAAATTCTTATTTACAACTATTTCCATTAGATTTTATTCTA-TTTATTAGTAAAAATTTTTGATAGAATCTCATATATTTTTATTATTCTTAATTAAAAAAAAAAATATTGAAAAGATTAATCAACGTATCATTCATCCTTTAATAATCTTTTTTATTAAATTTATCTCGAATTACATAATACCTTTAGAAA------------------------TTTCTATTATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCAAACCTTAATTTACAAAATAGAGCCTCCCCATTAATAGAACAAATTATTTTTTTCCATGATCATACACTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Plastingia_naga             

Orses_cynisca                ATTGGATTATTAGGATTTATTGTATGAGCTCACCATATATTTACAGATATATATTTACTTTACTCTAATTGCTGTCAAATATTTGATTAGTTTATTTGTACATACAGACTCATATTGAACTAGGATGTTTTTATACTGTAATTATAGAACTAGTTCACTTGTATACCCTTGTTCTTTTTTTTTTCTGACACCAAGTATGTTTTAGTGGATATTTAACCACATCAGATTAACAAAAACCCATATATACTATTTTATCTATTACTTATTACTTCA-TTTAGTAGTTGTATCTTTTGATAGTACCTCCTATATAATCATTATATTTATATTAAAAAAGAAATATTGAAAAAATTAATCAACGAATTGTTTACCCTTTAATAACCTTCTTTATTAAATTTACAGCAAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TAA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATCATTTTTTTCCATGATCATACATTAATCATTTTAATTATAATTACTATTTTAGTA-AGATACATAATAATAAGACTTTTTTTT  Orses_cynisca               

Perichares_philetes          ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGATATATATTTATCCTACTCCAACTGCTGTAAAATATTTGACTTGATCTTTTGTATATATAGTCTTATATTAAATTAGGATGTTTTTATACAGTTAATATAGAATTAGTCCACACGTATACTCTTGTTCCTTTTTATTTTTGTTACAAAATACGTTTTAGAGGATATTTAACCATATCAGATTAACTAAAATCCTTATATATAATCTTATCTATTAGATATTATTTTA-TTTATTAGTAACATCTTTTGATAGTATCTCATATATTTTCATTATATTTATGTAAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATACATTAATAATCATTTTTATTAAATCTTTTGCAAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TAA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTTCAAAATGGAGCTGCCCCCTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATATAATATTAAGACTTTTTTTT  Perichares_philetes         

Gangara_thyrsis              -------------------TTGTTTGAGCACATCATATATTTACTGAAATATATTTATTTTTCACTAATTCGTGTACAATATTAGATTAGTTCTTATCAATATATAGACTCATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGCTCTCTTGTATACTCTTGTTCCTTTATATTTTTGTTACTAAATATGTTTTGGGGGATACTTAATCTTATCTGTCTTTCTCTAATCCCTTTTTACAATTATTTCTATATGATATTATTCTA-TCTAATAGGAATTATACCAGATAGAATCTCTTATATTATTATTATTTATGTATAAGAAAAAAATTATTGAATAAATTAACCAACGAATTATTTATACTTTAATTACCTTTTTTATTAAATACCTTGCAAATAATATAACACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAACCTTAATCTTCAAAATAGAGCATCCCCTTTAATAGAACAAATCATTTTTTTTCATGATCATACCTTAATTATTTTAATTATAATTACAATTTTAGTT-AGTTATATAA-----------------  Gangara_thyrsis             

Zela_excellens               ----------TAGGATTTATTGTCTGAGCACATCATATATTTACAGAAATATATTTATTTTACTCAAATTGCAGTATCTTATTTGATTAGAACTTATCAATATACAGACTCATATTAAATTAGGATGTATTTATACAGTAAATATTGAATTAGTTCTCTTGTATACTCTCGTTCTTTTATGTTTTTGATACTCAATATGTTTTGGGGGATATTTAATCTTATCAGTTTATCTTAAATCCTTACATATAACTATTTCAATTAGTTTTTATTCTA-CTTATTAGGTATATCTTTTGATAGTATCTCATATATTATTTTAACTTTTATGTAAAAAAAAAAATACTGAACAAATTAATCAACGACCTATTTATTCATTAATCTTCATTTATATTAAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAGTAATTTTAATTATAATTACTATTTTAGTG-AGTTATATAATAATAAGTTA-------  Zela_excellens              

Kedestes_barberae            ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGATATATATTTATTTAACACTAATTGCAGTTTAATATTCGATTAGTTCTTAACAATATATAGACATATATTAAATTAGGACGTATCCTTACTGTTAATATTGAATTAGATCTCTTGTATACTTATGCTCATTTTTAATTTTGACTCAAAATATGTTTTAGAGGATATTCAACCTTATCAGATTAACTAAAATCCTTTTATGTAATTATCTCCATATGATTTTATTTCA-TTTAACTGTTATTTTATTTGATAGTATCTCTTATATCCTTATAATCTTTATATTAAAAAAAAAATATTGAATAAATTAATCAACGAATTATCCATCCTTTAATAAGCATTTTTACTTAATTACTTGCTAATTATATAATACCTCTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCCTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACATTGATTATTTTAATAATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Kedestes_barberae           

Isoteinon_lamprospilus       ATTGGTTTATTAGGATTTATTGTTTGAGCGCATCACATATTTACAGATATACATTTATTTATCACAAATTGCCGTTTTATATTAGATTAGTTCTTATCAATATATAGCCCTATATTAATTTAGGATGTATTCTTACTGTTGTTATAGAATTAGCCCTCATGTATACATATGTTCATTTATACTTTCGTCTCTAGATTTGATTTGGGGGATATTCAATCTTATCCGACTATCATAAATTCTTTTACATGATTATTACTATACGATTTTATTTCA-TTTACCTGGAATAATACTTGATAGCATCTCATATACATCAATTATTATTATATTAAAAAAAAAATACTGAAAAAATCAACCAACGAATTATTTATTCCTTAATAACCTTTTTTATTTAATTTCCCGCAAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAACCTTCAAAATAGAGCTTCACCATTAATAGAACAAATCATCTTTTTTCATGATCACACATTAATTATTTTAATAATAATTACTATTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Isoteinon_lamprospilus      

Astictopterus_jama           ATTGGATTTTTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGATATATATCTATTTTAATCTAATTGCTGTATATTATTCGATTAGATCTTATCAATATATAGTCTTATAATGAATTAGGATGTTTTCTTACTGTAAATAAAGAATTAGTTCTCTTGTATACTTATGTTCTTCTTTTCTTTTGTCTCTAAATATGTTTTGGGGGATATTTAATCTTATTAGATTAAATAAAATCCTTACTTATAATTATTTCTATATGATATTATTCCA-TTTAACTGAAATTTCATCCGATAGTATCTCATATACTATTTTTATTTCTTTTTTAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATCCTTTAATAGGCAATTATATTAAATTTAATGCTAACAATATAACACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAACTTTAATTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTCCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAACTTTATTTTTT  Astictopterus_jama          

Hidari_irava                 -------------------TTGTTTGAGCACATCATATATTTACAGAAATATATTAACTTTACTCTAATTGCTGTCCATTATTTGATTAGTCCTTATCAATATATAGACTTATACTAAATTAGGATGTATTTATACTGTAATTAAAGTATTAGATCCCATGCATACTCTTGTTCTTTAATACTTCTGCCTCTAAATATGTTTCGGGGGATATTTAATCTTATCAGATTAACTTAAATCCTTATCTTCTATTATTTCCATATGATTTTACTCCA-TTTAACTGAAGATATTTCTGATAGAATACCATATATATTTATAACTCTTATCTAAAAAAAAAAATATTGACTAAATTAATCAACGAATTATTTATTCCTTAATAAGCATATATACTTAACTTTTTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATTAATTTTCAAAATAGAGCCTCCCCACTTATAGAACAAATTATTTTTTTCCATGATCATATTTTAATTATTTTAATTATAATTACAATTTTAGTT-AGTTATATAATA---------------  Hidari_irava                 

Osmodes_lindseyi             ATTGGACTATTAGGATTTATTGTATGAGCACATCATATATTTACTATAATATATTTATTTAACCCTAATTGCAGTTAAATATTAGATTAGATCTCTTCAATATATAGTGTTATATTAAATTAGGATGTATTTATACTGTTAACTAAGTATTAGTTCTCTTGTATACCCTTGTTCTTTTATATTTTTGACTCTAAAAATGTTTCGGTGGATATTTAATCCTATCTGATTATCAAAAATCCTTATATACAATTATTACAATTTGATATTATTCTA-TTCCTTAGTAATATTTTTTGATAGTACCTCATATATTTTTATTATCCTTATTTCAAAAAAAAAATATTGACAAAACTAATCAACAAATTGTATACCCCTTAATAAGCATTTTTATTTAAATTAAAGCTAATAATATAATACCTCTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGC---TTA-----CCTTTTTTTAGAA--ATGGCAACATGATCTAACCTTAATTTACAAAATAGTGCTTCTCCTTTAATCCAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTACTTATAATTACTATTTTAGTT-AGTTATATAATATTAAGATTATTTTTT  Osmodes_lindseyi            

Gamia_shelleyi               -----------------TATTGTTTGAGCTCATCATATATTTACTGATATATATTTATTTAACTCTAATTGCTGTTTAATATTTGATTAGTTCTTTTCAATATATAGTCTTATATTAAATTAGGATGTATTTACACGTGAAATATACAATTAGATCTCATGCATACCTATGTTCATTTATATTTTTGTTACTAAATTTGTTTTGGAGGATGTTTAATCTTATCAGTTTAACTCTAATCCTTTTATACTATTATTTCTATATGATACTATTTTA-TTTATTAGTAATTTCTTTTGATACTATATCATATATATTTATAATTTTTATATAAAAAAAAATTTACTGAATAAATTAATCAACGAATTATTTATTCATTAATAATCATTTTTACTCAATTTTTTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTCCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAATTATTTTAATTATAATTACTATTTTAGTC-AGATATATAATAA--------------  Gamia_shelleyi              

Iambrix_salsala              -----------------TATTGTATGAGCTCACCATATGTTTACCGTTATATATTTATTTTACTCTAATTGCAATTTAATATTAGACTAGCTCGCATCAATATATAGACTTATATTAAATTAGGATGTATTTATACAGTTAATATAGAATTAGTTCTCATGTATACTTATGTTCTTTTTTACTTTTGATACAAAGTATGTTTTGGTGGATATCTAACCTTATCTGACTAACCCTAATCCTTATATATAATTATTTCTATTAGGTATTAATCTA-TTTATTAGATATTTCATTTGATAGTATCTCTTATATTATTGTAATTTTTATTTTAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTATTTCTCTAATAATCCTTTTTACTTAATTTCCAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTTTATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATTGCTACATGATCAAACCTTAATTTACAAAATAGTGCATCACCTATAATAGAACAAATTATTTTTTTTCATGACCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTA-AGATACA--------------------  Iambrix_salsala             

Idmon_obliquans              ATTGGTTTATTAGGATTTATTGTCTGAGCTCATCATATATTCACAGAGATATATTAATTTTACACTAATTGCTGTTTAATATTTGATTAGTTCTTATCAATATATAGTCTTATATTAATTTAGGATGTTTTCTTACTGTTAATAAAGAATTAGCTCCCATGTATACTCTTGTTCTTTTTTATTTTTGATACTAAATTTGTTTTGGAGGATATTTAACCATATCAGATTATCTTAAATCCTTTTTATTAACTATTTCTATTAGATTTTAATTTA-TTTAATGGAAATTTCACTTGATAGTTTTACCTACTTCATTATTATTTTTATTTTAAATAAAATATATTGATATCATTAATCAACGTATTATTACCTCTTTAATAACCTTTTTTATTAAATTTACCGCTAATAATATAATACCTTTAGAAA------------------------TTTCTATTATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TGGTTTTTTTAGAA--ATTGCTACTTGATCTAATTTTAATTTACAAAATAGAGCCTCACCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTCTCGTTATTTTAATTATAATTACTATTCTAGTT-AGATATATAATAATAAGATTAT-----  Idmon_obliquans             

Hyarotis_adrastus            --TGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACTGATATACATTTATTTACCTCTAATTGCAGTTTTATATTAGATTAGATTACATCAACATATAGAGTTATACTTAATTAGGATGTATTTATACTGTAAATAAAGAATTAGTTCTCTTGTATACCCTTGTTCACTTATTTTTTTGTTACTAAATATGTTTTGGGGGATATTTAACCTTATCAGATTAACTTAAACCCATATTTATAATTATTACCACTAGATTTTAATCCA-TTTATTAGAGATATTATTAGACAGTATTACGTATATTATTATAATATTTATATAAAAAAAAAAATATTGAAAAAATTAATCAACGAATCATTTATGCTTTAATAAGCATTTTTATTAAATTTTAAGCTAACAATATAATACCTTTAGAAT------------------------TTTCTATTATGGCAGATTACATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATCGCAACCTGATCAAATCTTAACTTACAAAATGCTGCTTCACCTCTTATAGAACAAATTATTTTTTTTCACGATCATACCTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAAT----------------  Hyarotis_adrastus           

Unkana_mytheca               -------------------TTGTTTGAGCTCATCATATATTTACAATAATATATCTATTTATCTCTAATTGCCGTAAAATATTCGATTAGTTCTTCTCAATACATAGACTTATAATAATTTACCATGTATTTATACAGTAAACATAGAATTAGTTCTCATGTATACTCTTGTACTTTTATATTTTCGTTACCAAATATGTTTTGGAGGATATTTAACCATATCTGCTTATTAAAAATAATTTTTTTTAATTATTACTATTAGATATTAATCTA-CTTAATAGATATAACTTCTGATAGTATTACTTATATAATCCTAATTTATTATTTAAATTAAAAATATTGATTAATTAAATCAACGAATTATTTACCCTTTAATAATCTTATTTACTCAATCTAATGCAAACCATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATATCAATCTTCAAAATAGAGCTTCTCCATTAATAGAACAAATTATCTTTTTTCATGACCATACTTTAATTATTTTAATTATAATTACTATTTTAGT-----------------------------  Unkana_mytheca              

Lotongus_calathus            ---------TTAGGATTTATTGTTTGAGCACATCATATATTTACTGATATATATTTTCTTAACTCAAATTGCTGTTAATTATTAGATTAGTTTATTCCAATATATAGTCTTATATTAAATTAGGATGTATTCCTACTGTGAATAAAGAATTAGATCTCTTGTATACACTTGTTCTTTTATACCTTTGTTACAAAAAATGTTTTGGAGGATATTTAATCCCTTCTGATTAACTAAAACTCTTATTTATAATTTTAACTATTAGATCCTAATCCA-TTTAATAGAAATTTTTTTAGATAGTATTACTTATATTTTTTTAACATTTAATTAAAAAAAAATATACAGAAAAAATTAATCAACGAGTTGTTTATTCTTTAATAACCTTTTTTATTAAATTTATTGCTAACAATATAATACCTTTAGAAT------------------------TTTCTAATATGGCAGATTTCATGTAATGGATTTAAACCCCATTTATAAAGGC---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAA-----------------  Lotongus_calathus           

Xanthodisca_astrape          ATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACAGATATATATTTATTTTACACTAATTGCTGTTTAATATTTGACTAGTTTATACCAATATACAGTCTTATATTAAATTAGGATGTATTTATACAGTAGATATTGTATCAGTTCACTTGCACACTCTTGCTCTTTTATTTTTTTGTCTCTAAATTTGTTTTGGAGGATATTTAACCTTATCAGATTAACTTAAACCCTTACTTACAATTATCTCTATTAGATATTATTTTA-TTTATTAGACGTTTCTTCTGATAGAACATCTTATATCATTCTTATCTTTATATTAAAAAAAATATATTAATTAAATTAATCATCAAATTATTTATTCATTAATAAGCATTTTTATTCAATTTATAGCTAATTATATAATACCTTTAGTAA------------------------TTTCTAATATGACAGACTATATGTGATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATCTTCAAAATAGTGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCACACATTAAT-ATCTTAATTATAATTACTATTTTAGTA-AGATATATAATAATAAGATTATTTTTT  Xanthodisca_astrape         

Ancistroides_nigrita_1       -----------AGGATCTATTGTTTGAGCCCATCACATATTTACAGATATATACTTACTTTACTCTAATTGCGGTATATTATTCGACTAGATCTTATCAATATATTCACTTATATTAAATTAGGATGTTTTTACACTGTAATTAAAGAATTAGCCCCCTTGTATACTTATGCTCATTTATACTTTTGTTACAAAATATGTTTTAGAGGACATTTAACCTTATCAGACTAATAAAAATCCTTTTTTTTAATTATCTCTATTAGGTTTTACTCTA-TTTATTAGTGGTAATTTCTGACAGAATCTCTTATATTTTTATTATTTTTATTTCAAAAAAAAAATACTGAATAAATTAATCAACGAATTATTTACCCCTTAATAATCATATTTAATAAATTTATTGCTAATAATATAATGCCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGCAATGGATTTAAACCCCATTTATAAAGA----TTATAACTTCTTTTTTTAGAA--ATGGCAACATGATCAAACTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAGCAAATTATTTTTTTTCATGATCACACTTTAATTATTTTAATTATAATTACAATTTTAGTT-AGTTATATAATATTAAGA---------  Ancistroides_nigrita_1      

Ancistroides_nigrita_2       -------------------TTGTTTGAGCCCATCACATATTTACAGATATATACTTACTTTACTCTAATTGCGGTATATTATTCGACTAGATCTTATCAATATATTCACTTATATTAAATTAGGATGTTTTTACACTGTAATTAGAGAATTAGCCCCCTTGTATACTTATGCTCATTTATACTTTTGTTACAAGATATGTTTTAGAGGACATTTAACCTTATCAGACTAATAAAAATCCTTTTTTTTAATTATCTCTATTAGGTTTTACTCTA-TTTATTAGTAATAATTTCTGACAGAATCTCTTATATTTTTATTATTTTTATTTCAAAAAAAAAATACTGAATAAATTAATCAATGAATTATTTACCCCTTAATAGTCATATTTACTAAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGCAATGGATTTAAACCCCATTTATAAAGA----TTATAACTTCTTTTTTTAGAA--ATGGCAACATGATCAAACTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCACACTTTAATTATTTTAATTATAATTACAATTTTAGTT-AGTTACATAATAATAA-----------  Ancistroides_nigrita_2      

Caenides_dacela              -------CTTCTGGTTTTATTGTATGAGCTCATCATATATTTACAATTATATATTTATTTTTCTCTAATTGCTGTTAATTATTTGATTAGTTCTTAACAATATATAGTCTTATATTAATCTTGGACGTATTTATACTGTTAATAAAGAGCTAGTTCTCTTGTATACTCTTGTTCTTTTTTACTTTTGTTACTAAATATGTTTTGGAGGATATTTAATCTTATCAGTTTATCTTAAATCCTTATTTATAATTATTTCCATTAGTTATTATTCTA-TTTATTAGAAATTTTTTTTGATAGTATATCTTATATTTTTTTAATTTTTATCTTAAAAAAAAATTATTGATTTTATTAATCAACGAATTATTTATTCTTTAATAAGCTTTTTTATCCAATCTCTTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATCTTAATTTACAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAGTTATCTTAATTATAATTACTATTTTAGTT-AGATACATAATAATTAGATTATTTTT-  Caenides_dacela             

Andronymus_evander           ----------TAGGATTTATTGTGTGAGCACACCATATATTTACAGATATATATTTATTTTAATCTAATTGCAGTATTATATTTGATTAGATTATATCAATATATAGACATATATTAAATTAGGATGTTTTTACACAGTAAATAGAGAATCAGTTCACATGTATACTCTTGTTCTTTTATTTTTTTGTCTCTAAATATGTTTTGGAGGATATTTAACCCTATCCGATTAACTTAAATCCTTATACTTAATTATTTCAATTAGATTCTACTTTA-TTTATTAGCAAATTCACTAGATAGTATATCTTATACTTTTATCATTTTTAATTTAAATAAAAAATATTGAATAAATTAATCAACGAATTATTTACCCATTAATAATCCTCTATATTCAATTTATTGCTAATTATATAATACCTTTAGAAT------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TT-----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATAAATTTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTCTAATTATAATTACTATTCTAGTT-AGTTACATAATAATAAGATTATT----  Andronymus_evander          

Paracleros_biguttulus        ATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTAACTCTAATTGCAGTTTAATATTCGATTAGCTCTCAAAAATATATAGTCCTATACTTATTTAGGATGTTTTCTTACTGTTATCTATGAATTAGTTCCCTTGTATACTCTTGTTCTTTTATATTTCTGTTACTAAATACGATTTGGGGGGTATTTAACCTTATCTGATTAACTTAAATCCTTTTATTTAATCATTTCTATCAGATTTTATTTTA-TTTAATAGAAATCATTTTAGATAGAATACCATATATTTTTTTTATTTCTTTATCAAAAAAAAAATATTGAATAAATTAATCAACGTTTTATTTATCCCCTTCTAATCATATATATTAAAATTTCTGCTAACAATATAATACCTTCAGTAA------------------------ATTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TAATTTATCCTTTTTTTAGAA--ATTGCAACATGATCTAATCTTAATTTACAAAATAGTGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATCATTTTAATTATAATTACTATTTTAGTA-TCTTACATAATATTAAGATTATTTTTT  Paracleros_biguttulus       

Meza_meza                    -------------------------GAGCCCATCATATATTTACTGAAATATATCTATTTTACCCAAATTGCTATTTAATATCTGATTAGATCTTATCAATATATTCTCTTATACTAATTTAGGATATTTTTACACTGTAAATAAAGAATTAGTTCCCTTGTATACTTATGTTCTTTTTTCTTTTTGTTACAAAACATAATTTGGGGGTTATTTAACCTCTTCTGATTAACTTAAATTCATATTTATAATTATTATTATGAGATATTATTCTA-TTTAACTGATGTATCTCTTGATAGTACCTCTTATATTTCTATTACATATTCTGAAATAAAAATTTGATGAAAAAATTAATCAACGAATTATTTATCCTTTAATAATCTTTTTCATTCGCTTTAATTCTAATTATATAATACCATTAGTAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATAGCAACATGATCGAATTTAAATCTACAAAATAGTGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTACTTATAATTACTATTTTAGTA-A--------------------------  Meza_meza                   

Ceratrichia_clara            ------------GGATCTATTGTATGAGCACATCATATATTTACAGCAATATATTTATTTTTCACTAATTGCAGTATAATATTTGATTAGCTCTTTTCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTTAGTACAGAGTTAGTCCTCTTGTATACATATGTTCTTTTATATCTCTGTTACTAAAATTAATTTGGGGGGTATTTAATCATACCAGATTATCTTAAATAAATTAATATAATTATTACAATTAGATACTGCTTTA-TTTATTAGTTATTTTTTTAGATAGAATTACGTATATTATAATTACTAATATATTAAAAAAAATTTATTGAATAAATTAATCATCGAATTATTTATTCTCTTATAATCATTTTTATTAAATCTATAGCTAATTATATAATACCGTTAGAAA------------------------TTTCTATTATGGCAGAATATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATAGCAACATGATCTAATCTTAATTTACAAAATAGAGCCTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTACTTATAATTACAATTTCAGTT-AGATATATAATAATAAG----------  Ceratrichia_clara           

Megathymus_streckeri         ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGATATATATTAATTTTACACTAATTGCAGTAATTTATTTGATTAGTACTTAAAAATATATAGACTTATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGTTCTCTTGTATACTCTTGTTCCTTTATATTTTTGATACTAAAAACGTTTCGGAGGATATTTAATTATATCCGATTAACTTAAATTCTTATTTATAATTATTTCAATTAGATATTATTTTA-TTTATTATAAATAATTTCTGATAGTATTACTTATACAATTATTATTTTTATTTAAAAAAAAAAATATTGAAATTATTAATCAACGTTTAATTTATTCATTAATAATCTTTGTTACTTAATTTCCTAATAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTTAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTCTTCCATGATCATACCTTAATTATTTTAATTATAATTACCATCTTAGTT-AGATATATAATAATAAGATTATTTTTT  Megathymus_streckeri        

Agathymus_mariae             ---------TTAGGATTTATTGTTTGAGCTCATCACATATTTACAGAAATATATTTATTTTTTACAAATTGCAGTAAAATATTTCATTAGACCTTATCAATACATAGACTTATATTAAATTAGGATGTATTCTTACTGTAATTAAAGAATTAGTTCTCTTGTACACCCTTGCTCTTTTATACTTTTGCTACTAAATATGTTTTGGCGGATATTCAACCATATCAGATTAACCTAAATTCCTACTTATAATTATTTCAATTAGATACTAACCAA-TTTAATAGGAATAATTCTTGATAGTACTACCTATATTATTATTATTCTTATTTAAAAAAAAAAATATTAAATTTATTAATCAAAATATTATTTATTCCTTAATAGTCATATTTGCTTAATTTCCTGCTAATCATATAATACCCTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAAACCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATTTACAAAATAGAGCCTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACCTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGAT--------  Agathymus_mariae            

Pyrrhopygopsis_crates        ATTGGTTTATTGGGATTTATTGTATGAGCTCATCATATATTCACTGATATATATTAATTCTACTCTAATTGCTGTAAATTATTTGGCTAGAACTTATCAATATATAGTCTAATATTAAATTAGGATGTATTTATACTGTAGATGAAGAATTATACCACTTGTACACTCTTGTACTTTTTTATTTTTGTTACCAAATATGTTTTGCAGGATATTTAACCATATCTGGCTATCTCTAATAATTATTTATATTTATTTCCATTAGATTTTACTCCA-TTTAATAGAAATATCTTTTGATTGTATCACCTATATTTTTATCATTTTTATTTTAAAAAAAAAATATTGAAAAAATTATATACCGAATTATTTATCCTTTAATAACCTTTTTAATTAAATCTGCTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAAA-ATGGCTACATGATCTAATTTAAATCTTCAAAATAGAGCTTCACCCTTAATAGAACAAATTATTTTTTTTCATGATCATACAATAATAATTTTAACTATAATTACTATTTTAGTT-AGTTATATAATAATTACTTTATTTTTT  Pyrrhopygopsis_crates       

Iton_watsonii                -------------GATTTATTGTATGAGCTCACCATATATTCACTGAAATATATTAATTTTTCCCTAATTGCAGTTATATATTTGATTAGTTCTTATCAATATATAGACTAATATTAAATTAGGATGTATTCATACAGTAAATAAAGAACTAGTTCACATGCATACTCTTGTTCTTTTATTTTTTTGATACTAAATATGCTTTGGAGGATATTTAATCTTATCAGATTAACTTAAATCCTTACTTATAATTATTACTATTTGTTTTTATTTCA-TTTAATAGAAACATTTCCTGATAGTATCTCCTATATTTTTATAATTACTATATAAAAAAAAAAATATTGAATAAATTAACCAACGAATTATTTACCCCTTAATAAACCTTTTTATTAAATTTATTGCTAACAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCCTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATATAA-----------------  Iton_watsonii               

Polytremis_pellucida         ---------------TTTATTGTCTGAGCTCATCATATATTTACAGAAATATATTTATTTTTCCCTAATTGCAGTAATATATTCGATTAGTTCTTAACAATATATAGTCATATATTAAATTAGGATGTATTTATACAGTTGACAAAGAATTAGTTCACATGTATACTCTCGTTCATTTATATCCTTGCTACTAAGTATGTTTTGGAGGATATTTAATCATACCAGATTAACTTAAACCCATATTTATAATTATTACTATTTGATATTATTTTA-TCCAATAGAAATATTTTTTGATAGTATCTCTTATATTTTTTTTATTTTTATATAAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATCCTTTAATAAACATTTTTACTTAATCTAATGCTAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATAGAGCTTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACCATTTTAGTA-AGATATATAATAATAAGT---------  Polytremis_pellucida        

Pelopidas_mathias            ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATATATTTAATTTACACTAATTGCTGTTAAATATTCGATTAGTCCTCATCAATATATAGACTTATACTTAATTAGGATGTATTTACACTGTAAATAAAGAATTAGTTCACCTGTACACTCTTGTTCCTTTTTTTCTTTGCCACTAAATATGTTTTGGGGGATATTTAATCTTATCAGATTAACATAAATCCTTACTTATAATTATTACTATTTGATTTTACTCTA-TCTATCTGTTATAACTCTAGATAGTATCACATATATATTTATAATTTTTGTATAAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATTCATTAATAATCTTTTTTACTAAATTTATTGCTAATCATATAACACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATATTAATTTACAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATATAATAATTAGTTTATTTTTT  Pelopidas_mathias           

Pelopidas_thrax              ------------GGATTTATTGTATGAGCTCATCATATATTTACTGATATATATTTAACTTACACTAATTGCAGTAAAATATTTGATTAGTTTATAACAATATATAGACTTATACTTAATTAGGATGTATTTATACAGTAAATAAAGAATTAGTTCACTTGTATACTCTTGTTCTTTTTTTTTTTTGATACAAAATATGTTTTGGAGGATATTTAACCTTATCAGATTATCTTAAACCCATATTTATAATTATTACCACTTGATATTATTCTA-CTTAACTGTAATAATTTTAGATAGTATTACATATATAATTTTTATTTTTATATAAAAAAAAAATTATTGAAAAAATCAATCAACGAATTATTTACTCATTAATAAATTTTTCTATTAAATTTATTGCTAATAATATAATGCCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATATTAATTTACAAAATAGAGCTTCACCCTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATACATAATAATTAG----------  Pelopidas_thrax             

Taractrocera_papyria         ATTGGATTATTAGGATTCATTGTTTGAGCTCATCATATATTTACTGTTATATATTTATCTAACTCTAATTGCCGTCAAATATTTGATTAGCACATAACAATATATAGACAAATATTAAATTAGGATGTATTTACACCGTAAATAAAGAATTAGATGTGTTGTATACTTATGTTCATTTATATTTTTGTTACTAAAAATGTTTTGCAGGATATTTAATCATATCAGATTAATAAAAATCCTTATATATAATTATTACAATTTGATATTAATCTA-TTTAATAGAAAAATTTTTTGATAGTATTACTTATATCTTTATAATTATTATATATAAAAAAAAATATTGAATAAATTAATCAACGAATTATCTATCCTTTTATAATCTTTTTTACTAAATCTCATGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAACCTTAATTTACAAAATGGAGCTTCACCTCTTATAGAACAAATTATTTTTTTCCATGATCATACTTTGATTATTTTAATTATAATTACTATTTTAGTA-AGTTATATAATAATAAGATTATTTTTT  Taractrocera_papyria        

Ocybadistes_walkeri          ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTTATATATTTTTTTTACTCTAATTGCTGTCTAATATTAGATTAGCATATACCAATATATAGTCCAATATTAATCTAGGATGTATTTACACTGTAATTAAAGTATTAGACCTCATGTATACTCATGTTCATTTATATCCCTGTTACTAAAAATGTTTCGCAGGATATTTAATCTTATCAGATTAATAAAAACCCTTACATACAATTATTACAACTAGATGTTATTCCA-TCTATTAGGTATATCTTTTGATAGAATCACTTATATTTTTTTTATCTTTATATACAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATCCTTTTATAATCATCTTTATTAAATTTATCGCAAACAATATAATACCTTTAGAAA------------------------ATTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA----TA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATTTACAAAATAGAGCCTCTCCTCTTATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATATAATAATAAGATTATTTTTT  Ocybadistes_walkeri         

Potanthus_sp.                ATTGGATTATTAGGATTTATTGTTTGAGCACATCATATATTTACTATTATATATTTAATCTACCCTAATTGCTGTTTAATATTCGATTAGTATGCAACAATACACAGACTCATATTAAATTAGGATGTATTTATACTGTAGTTAAAGAATTAGATCTCTTGTATACTTATGCTCATTTTTATTTTTGTTACTAAAAATGTTTTGCAGGATATTCAATCCCACCAGATTAACAAAAATCCTTATATACAATTATTACAATTTGATATTATTCTA-TCCAATAGTCATAATTTCAGATAGAATTACTTATATTTTTCTTATTTTTACATATAAAAAAAAATATTGAAAAAATTAATCAACGAATTATCTATCCTTTTACAATCATCTTTATTAAATCTATTGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGC---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTACAAAATAGAGCTTCCCCCCTTATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGTTTATTTTTT  Potanthus_sp.               

Suniana_sunias               ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGATATATATTTAATTTACTCTAATTGCTGTTTAATATTAGATTAGTATATATCAATATATAGACTAATACTAAATTAGGATGTATTTATACTGTAATTAAAGAATTAGATCTCATGTATACTCTTGTTCATTTATATTTTTGTTACTAAAAATGTTTTGCAGGATATTTAACCATATCAGATTAATAAAAATCCTTATATATAACTATTACAATTAGATATTATTTTA-TTTAATAGATATATCTTCTGATAGTATTACATATATTATTCTTATTTTTATATCTAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTTACCCTTTAATAAAGATATTTATTAAATCTTCTGCAAACTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAACCTAAATTTACAAAATAGAGCTTCACCTCTTATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTTTAATTATAATCACTATTTTAGTA-AGATACATAATAATAAGATTATTTTTT  Suniana_sunias               

Arrhenes_dschilus            ATTGGATTATTAGGATTTATTGTATGAGCACACCATATATTTACTGTAATATATTAGCTCTTCTCTAATTGCAGTTCAATATTAGATTAGATCTTTCTTATATATAGTCAAATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATTAGATCACATGTATACTCTTGTTCTTTTTTATTCTTGTTACAAAATATGTTTTGCAGGATATTTAACCATATCAGATTAACAAAAATTCTTATTTATAATTATTACTACTTGATATTACCCTA-TTTATTAGTTGTTATTTTTGATAGAATTACTCATATATTATTTACTTTTATTTCTAAATAAATATATTGAATTTATTTATCAACGAATTATTTATCCTTTAATAATCTTCTTTATTAAATTTAATGCTAATAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCCAATCTTAATTTACAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGATACATAATATTAAGATTATTTTTT  Arrhenes_dschilus           

Telicota_argeus              ATTGGATTATTAGGATTTATTGTTTGAGCACATCATATATTTACTGAAATATATTTATTTAACACTAATTGCTGTTTAATATTAGATTAGATCTTAACAATATATAGTCTAATATTAAATTAGGATGTATTTACACAGTAAATATAGTACTAGACCACATGTATACATATGTTCATTTTTATTTTTGTTACTAAATATGTTTTGCAGGATATTTAATCTTATCAGATTAATAAAAATCCATATTTATAATTATTTCTACTTGATATTACTCTA-TTTAATAGATATTACATTGGATAGTATCTCTTATATAATTTTAATTCTTATTTTTAAAAAAATATATTGAAAAAATTAATCAACGAATTATTTATTCTTTAATAATCATTTTTATTAAATTTATTGCAAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCCAATCTAAATTTACAAAATGGAGCTTCCCCCCTTATAGAACAAATCATTTTTTTCCACGATCATACATTAATTATCTTAATTATAATTACTATTTTAGTA-AGCTATATAATATTAAGATTATTTTTT  Telicota_argeus             

Cephrenes_augiades           ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAATTATATATTTATTTTACTCTAATTGCCGTATATCATTAGACTAGACCTTAACAATATATAGACTTATATTAAATTAGGATGTATTTATACTGTAAATAAAGAATCTGATCTCATGTATACTCTCGTTCATTTATACTTTTGTTACTAAATATGTTTTGCAAGATATTTAATCTTATCAGATTAATAAAAACCCTTATCTATAATTTTATCTATTAGATATTAATTTA-TTTAATAGTTGTAACATTGGATAGTATTACATATATATTTTTTATTCTTATTTTTAAAAAAAAATACTGAAAAAATTAATCAACGAATTATTTATACTTCTATAACCCTATTTATTAAATCTTATGCTAATTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCAAATCTTAATTTACAAAATGGAGCTTCCCCCCTTATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTA-AGATATATAATATTAAGATTATTTTTT  Cephrenes_augiades          

Sabera_caesina               --------------------TGTATGAGCTCATCATATATTTACTGAAATATATTCATTTTACTCTAATTGCAGTTAATTATTTGATTAGATCTTATCAATATATAGACTAATATTAAATTAGGATGTATTTATACTGTAATTAAAGAACTAGTTCACATGTATACCCTCGTTCATTTATATTTTTGCTGCTAAATATGTTTTGCAGGATATCTAACCTTATCAGATTATCTAAAATCCTTATTTATAATTATTTCTATTAGATTTTATTTTA-TTTATTAGTAGTAACATCTGATAGAATTACCTATATTATTATAATTTTTATTTTTAAGAAAAAATATTGAATAAATTAATCAACGAATTATTTATCCATTAATAAGCATTTTTATTAAATACATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATCTTAATCTTCAAAATGGAGCTTCTCCACTTATAGAACAAATTATTTTTTTTCATGATCACACTTTAGTTATTTTAATTATAATTACTATTTTAGTA-GGATATATAATA---------------  Sabera_caesina              

Ancyloxypha_numitor          --------------------TGTTTGAGCTCACCATATATTTACTGTAATATATTTATTCATCTCTAATTGCTGTAAATTATTTGGTTAGAACTTAACAACACATAGAGTTATAATAAATTAGGATGTATTTACACAGTAATCTAAGAATTAGTTCTCATGTATACATACGTTCATTTTTATTTTTGTTACAAAATTTATCTTGCATTATATTTAATCTTATCAGATTAACTCTAATTCTTATTTACAATTATTACAATCAGATACTACTTTA-TTTAATAGTTATAACATTTGATAGAATCTCATATATAATTATTATTTCTTATTTAAAAAAAAATTATTGAAATTATTTATCAACGAATTATTCATTCATTAATAACCCTATTTAATAAATTTTCTGCCTTTTATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATTGCAACATGATCTAATATTAATTTACAAAATAGAGCTGCACCATTAATAGAACAAATTATTTTTTTTCATGATCATACTCTTATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATA---------------  Ancyloxypha_numitor         

Oarisma_garita               ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGATATATATTTATTTTTCACTAATTGCAATTAAATATTAGATTAGATCTTATCAATATATAATCTCATATTAATTTAGGATGTATCTATACTGTAAATATAGAATTAGTTCACTTGTATACTCTTGTTCTTTTATATTTTTGATACAAAAAATGTTTTGCAGGTTATCTAATCTTATCAGATTAACATAAACCCATTTTTATAATTATTTCTATTAGATATTACTTTA-TTTAATAGATATAATTTCCGATAGTATTACTTATATATTTATTATTTCTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGAATTATTTATTCTTTTATAATCTTCTTTATTAAATTTATAGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACTTACAAAATGGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATCATTTTAATTATAATTACAATTTTAGTA-AGATATATAATAATAAGACTATTTTTT  Oarisma_garita              

Copaeodes_aurantiaca         ATTGGATTATTAGGATTTATCGTTTGAGCTCATCATATATTTACAGTTATATATTAAATTCCCACTAATTGCAGTAAAATATTTGATTAGATCTTATCAATACATAGTCAAATATTAAATTAGGACGTATTCTTACAGTTAATATAGAATTAGTTCACTTGTATACACTTGTTCTTTTATTTTTTTGATACTAAAAATGTTTTGCAGGATATTTAATCTTATCAGACTAATATAAATCCTTACTTATAATTATTTCCATTAGATATTATTCTA-TTTAATAGAGATATTTTTAGATAGTATTACTTATATATTTTTAACTTTTAATTAAAAAAAAAAATATTGAATAAATTAATCAACGAATTATTTATTCTTTAATAAATTTTTTTATTGAATTTATTGCTAATTATATAACACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATCTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATATCAATCTTCAAAATGGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACAATCTTAGTT-AGATATATAATAATAAGATTATTTTTT  Copaeodes_aurantiaca        

Dubiella_belpa               ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAATGATATATTAATTCTTCTCCAATTGCAGTATAATACTTGATTAGTTCTTACCAATATATAGACTTATATTAATTTAGGGTGTATTTATACAGTTGATAAAGAATTAGATCTCATGTATACATATGTTCTTCTATACCTTTGACTCCAAATATGTTTTGCAGGATATTTAATCTTATCAGATTAACATAAATTCTTATTTATAATTATTTCAATTAGATATTAATCAA-TTTAATAGAAATAGTTTTAGATAGTATTACTTATATAATTATAATTATTATATTAAAAAAAAAATATTAAATTTTTAAATCAAAATATCACATATTCATTAATAAGTATTTATATTAAATCTTTTGCTAATTATATAACACCTTTAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTTAACCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTCTTCCATGATCATACTTTAATTATTTTACTAATAATTACTATTTTAGTT-AGTTATATAATATTAAGATTATTTTTT  Dubiella_belpa              

Thracides_phidon             ---------------------------------------TTTACAGAAATATATTTACCTTTCTCAAATTGCTGTTTAATATTAGATTAGTACTCAACAATATATAGACAAATATTAAATTAGGATGTATTTATACTGTATATAAAGAATTAGTTCTCATGTATACTTATGTTCATTTATAATCTTGATACTAAATTTGTCTCGCAGGATATTTAATCTTATCTGATTAACTTAAATTCTTATTTATAATCATTTCTATTAGATTTTATCTTA-TTTAATAGAAATATTTTTAGATAGTATTACTTATACATTTGTAATTTTTATATTAAAAAAAAAATATTGAATTTATTAATCAACGAATTATTTATTCACTTCTAATCATTTATATTAAATTTACAGCTAATAATATAATACCTTTACAAA------------------------CTTCTAATATGGCAGAATATATGTTATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATCATAATTACTATTTTAGTA-ACTTATATAATAATTAGTTTA------  Thracides_phidon            

Talides_sinois               ----------TAGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTCATCTTAATCTAATTGCTGTAATTTATTTGATTAGATTATATCAATATACAGACTTATATTAAATTAGGATGTCTTTACACAGTAAATAAAGAATTAGTTCTCTTGTATACTCTTGTTCATTTATAATCTTGATACTAAATATGTTTTGCAGGATATCCAACCTCTTCAGTTTATCTTAAATCCATACTTCTAATTATTACTATTAGATATTATTCCA-TTTAATAGAAATATTTTCTGATAGTATCACTCATATATTTATAATTTTTATATTAAAAAAAATTTATTGAATAAATTAACCAACGTATTATTTATCCTTTAATAATCATCTCTACTTAATTTATTGCTAATAATATAATACCTTTAGAAT------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCCTCCCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATATT-------------  Talides_sinois              

Calpodes_ethlius             ATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTAATCCTACTCTAATTGCTGTAAAATATTAGATTAGATTATATCAATATATAGTCTAATATTAAATTAGGATGTATTTATACAGTAAATACAGAATTAGTCCTCTTGTATACTTATGTTCTTTTATACTCTTGTTACTAGATATGTTTTGCAGGATATTTAATCATATCAGATTAACTTAAATCCTTATCTTTAATTATTTCTATTAGATATTACTTTA-CCTAATAGATATTTTTTTTGATAGAATCTCATGAATATTTTTAATTTTTATATTAAAAAAAAAATATTGAAATTATTAATCAACGTATTATTTACTCATTAATAAGCTTCTATATTAAATTTATTGCGAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATTTAAATCTTCAAAATGGTGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGTTTATTTTTT  Calpodes_ethlius            

Saliana_esperi               -----------AGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTTATCTTTCTCTAATTGCTGTAAAATACTTGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATTTATACTGTAAATATAGAATTAGTTCTCATGTATACTCTTGCTCTTTTATATTCTTGTTACAAAAAATGTTTTGCAGGATATTTAACCTTATCTGATTAACTTAAACCCTTATTTACAATTATCTCTATTCGATACTATTTTA-CTTATTAGATATATCTTTTGATAGAATCTCTTATATATTTTTAATTCTTATATAAAAAAAAAATTATTGAAATTATTAATCAACGAATTATTCACTCATTAATAAACATTTATACTTAATTTACTGCAAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAACTTAAATCTCCAAAATAGTGCTTCACCTTTAATAGAACAAATCATTTTTTTTCATGATCACACTTTAATTATTTTAATTATAATTACCATTTTAGTT-AGTTACATAATAATAAGTT--------  Saliana_esperi              

Synapte_silius               ATTGGTTTATTAGGATTTATTGTATGAGCTCATCACATATTTACTGAAATATATTAATTTTACACTAATTGCTGTAAAATATTTGATTGGATCTTATCAATATATAGTCTAATATTAAATTAGGATGTATTTATACTGTTAATATAGAATTAGTTCCCATGTATACTTGTGTTCATTTTTATTTTCGTTACTAAATACGTTTTGCAGGATATTTAACCATATCAGATTAACATAAATCCATATTTATAATTATTTCAATTAGATTCTAATTCA-TTTAATAGTAAAAACTTCTGATAGTACCTCTTATACATTAATTATTTTTACATTAAAAAAAATATATTGAATAAATTAATCAACATATTATTTATTCATTAATAAGTATCTATACTTAATATGTAGCAAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATTTAAACCTTCAAAATGCAGCTTCTCCATTAATAGAACAAATTATTTTTTTCCACGATCATACTTTAGTTATTTTAATTATAATTACCATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Synapte_silius              

Anthoptus_epictetus          ATTGGATTATTAGGCTATATTGTTTGAGCCCATCATATATTTACAGATATATATTTATTTTACTCTAATTGCTGTTATATATTTGATTAGTTCTTACCAATATATAGAGATATATTAATTTAGGATGTATTTATACAGTAAATAAAGAATTAGTCCACATGTATACTCTTGTTCCCCTATAATTTTGTTACTAAATACGTTTTGCAGGATATTTAACCTTATCAGATTAACATAAATTCTTATTTATAATTATTTTAATTAGATATTATTTTA-TTTAATAGAAATTTCTTCTGATAGAACCTCATATATCTTTATTATATTTATATAAAAAAAAAAATATTGAAAAAATTAATCATCGTATTATTTATTCATTAATAATCATTTATACTAAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTATTGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTTTAATTAGAATTACTATTTTAGTA-AGTTATATAATAATAAGATTATTTTTT  Anthoptus_epictetus         

Corticea_corticea            ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGATATATATTTACTTTACTCAAATTGCAGTAAAATATTTGATTAGTCCATACCAGTATACAGACCTATATTAAATTAGGATGTATTTATACAGTTAACTAAGAATTAGTTCTCATGTATACTCATGCTCATTTTTACTTTCGTTACAAAATATGTTTTGCAGGATATTTATTCCTATCAGATTAACTTTAATAATTATTTATAATTATTTCTATTAGATATTACTTTA-TTTAATAGACATTATTTTAGATAGTATTACATATATTTTTTTAATTTTTATGTTAAAATAAAAATATTGAAAAAATTAATCATCGTATTATTTATTCATTAATAATCTTCTATATTAAATCTCTTGCTAATAATACAATACCTTCAGAAA------------------------CTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCCTCTCCGTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAGTTATTTTATTAATAATTACTATTTTAGTA-ACTTATATAATAATAACATTATTTTTT  Corticea_corticea           

Vinius_letis                 -----------AGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTTTTTTCACACTAATTGCAGTAAATTATTTGATTAGATCTCATCAATATATAGTCCAATATTAAATTAGGATGTATTTATACCGTAAATATAGAATTAGTTCTCTTGTATACACTTGTTCTTTTTTAATTTTGTTACTAAATACGTTTTGCAGGATATTTAACCATATCCGATTAACTTAAACCCTTATTTATAATTATTTCAATTAGATTTTAATTCA-TTTATTAGAAATTATTTTAGATAATATCTCTTATATTTTTTTTATTACGATTTTAAAAAAATATTATTGAATAAATTAAACAACGTTATATTTATTCATTAATAATCTTCTCTACTTAATTTATTTCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCACAACTTAATTTTCAAAATAGAGCTTCACCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-ATTTATATAATAATAAGATT-------  Vinius_letis                 

Sodalia_coler                -----------AGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTTACTCTAATTGCAGTCATATATTTGATTAGTATATATCAATATATAGACTTATATTAAACTAGGATGTATTTATACTGTAATTATAGAATTAGTTCTCTTGTATACTCTTGTTCTTTTGTATTCTTGTTACTAAATATGTTTTGCAGGATATTTAACCACATCAGATTAACTTAAATCCATACATATAACTATTTCTATTAGATACTAACCCA-TTTATTAGTAGTATTTTCTGATAGTATCTCATATATAATTTTTATTTTTACATTAAAAAAAAAATATTGAAATTATTAATCAACGAATTGTTTATTCATTAATAAACTTTTATACTTAATTTAATGCAAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTTCAAAATAGAGCTTCCCCTTTAATGGAACAAATTATTTTTTTCCATGATCACACCTTAATTATTTTAATTATAACTACTATTTTAGTA-AGTTATATAATAAT-------------  Sodalia_coler               

Eutychide_olympia            ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTATATATTTATTTTACTCTAATTGCAGTATAATATTTGATTAGATCTTAACAATACATAGTCTTATATTAAATTAGGATGTATTTACACTGTAAATATTGAATTAGTTCTCATGTATACTCTTGTTCTTTTATATTTCTGATACAAAGTATGTTTTGCAGGATATTCAACCACATCAGATTAACATAAATCCTTATATATAATTATTTTAATTAGATATTACTTCA-TTTATTAGACATAATATCTGATAGAATCTCTTATATAATTATAATTTTTATATTAAAAAAAAAATATTGAAATTATTAATCAACATATTATTTATTCCTTAATAATCTTCTATACTTAATATATCGCTAATTATGTAATACCTCTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAC-ATGGCAACCTGATCTAACCTTAATCTTCAAAACGCAGCTTCCCCATTAATAGAACAAATTATTTTTTTCCACGATCATACTTTAATTATTTTAATTATAACTACTATTTTAGTT-AGTTACATAATAATAAGATTATTTTTT  Eutychide_olympia           

Eutychide_paria              ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATCTATTCTACTCAAATTGCAGTATTATATTTGATTAGTCCTTAACAATATACAGTCTTATATTAAACTAGGTCGTATTTATACTGTAAATATTGAGTTAGTTCTCATGTATACTCTTGTTCTCCTATATTTTTGATACAAAATATGTTTTGCAGGATATTCAATCATATCAGATTAACATAAATCCTTATATATAATTATTTTAATTAGATTTCATCCCA-TTTAGTAGAAATTATTCTTGATAGAATCTCTTATATAATCCTAATTTTTATATTAAAAAAAAAATATTGAAATCATTAATCAACATATTATTTATTCATTAATAACCCTCTACACTTAATATACTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAACCA---TTA----TCCTTTTTTTAGAAC-ATGGCAACTTGATCTAATCTTAATCTTCAAAATGCAAATTCCCCATTAATAGAACAAATTATCTTCTTTCACGATCATACATTAATCATTTTAATTATAACCACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Eutychide_paria             

Lento_xanthina               ATTGGACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACTGAAATACACTAAATTATCTCCAATTGCTGTATAATATCTGATTAGTTCTTTACAATATATAGAGCTATATTAAATTAGGATGTATTTATACCGTCAATATTGAATTAGTCCTCTTGTATACTTATGTTCTCTTATTTTTTTGGCTCTAAAAATGTTTTGCTGGATATTTAATCTTATCAGATTAACTTAAACCCCTATATATAACTATTTCCATTAGATTTTATTCTA-TTTAATAGTAATATCTTTTGATAGTATCTCTTATATAATTATTATTTTTATATAAAAAAAAAATTATTGAAAAAATCAATCAACATATTATTTACTCATTAATAACCATTTATACTTAACACATTGCTAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATATTAATCTTCAAAACGGAGCATCTCCTCTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Lento_xanthina              

Callimormus_radiola          ATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGATATATATTTATTTTACTCTAATTGCAGTAAAATATCTGATTAGTTCTTATCAATATACAGACTTATACTTATTTAGGGTGTTTCTATACAGTAAATAAAGAATTAGTTCTCTTGTATACTTATGTTCTTTTTTACTCTTGTCACTAAATATGCCTTGCAGGATATCTAATCTTATCAGATTAACTTAAACCCATATCTTTAATTATTTCTATTAGGTATTACCCTA-TTTAATAGTTATTACATTTGATAGTATCTCTTATATATTTATTATTATTACTTTAAAAAAAAATTATTAAAAAAATTGATCAACGTATTATTTATAGCTTAATAAACTTCTTTACTTAATCTACAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTG----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATTTAAACCTTCAAAACAGAGCCTCCCCATTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATATTAAGATTATTTTTT  Callimormus_radiola         

Penicula_roppai              ATTGGTTTACTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTAAATTTACTCTAATTGCAGTAATTTATTTGATTAGTTCTTATTTATATATAGACTTATATTAAATTAGGATGTTTTTATACAGTATATAATGAATTAGTTCTCTTGTATACTCTTGTTCTTTTTTATCTTTGTTACTAAATATGTTTTGCAGGTTATTTAACCATATCAGATTAACTTAAATCCTTACTTATAATTATCTCTATTAGATATTATTTAA-TTTAATAGTTATAATTTTTGATAGTATTACCTATATCATTTTTATTCTTACATAAAAAAAAAAATATTGAAAAAATCAATCAACGTTATATTTATTCTTTAATAATCAATTATACTCAATTTTTTGCTAATCATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGTGCTTCCCCATTAATAGAACAAATCATCTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-ACATATATAATAATAAGATTATTTTTT  Penicula_roppai             

Niconiades_xanthaphes        ATTGGTCTTTTAGGATTTATTGTATGAGCTCATCATATATTCACAGAAATATATTGAACCTCCTCTAATTGCAGTTATATATTTGATTAGTTCTTCTCAATATATAGTCTTATATTAAATTAGGATGTATTTACACAGTAAATATAGAATTAGTTCACATGTATACCCATGTTCATTTATATTTTTGACACTAAATATGTTTTGCAGGTTATCTAATCATACCTGATTAACTTAAACCCTTACTTTTAATTATTTCAATTAGATTTTATTCTA-TTTAATAGTTATTACTTTTGATAGTATCTCTTATATATTTTTAATTACTATATTAAAAAAAATATATTGAAAAAATTAATCAACGTTATATTCTTTCATTAATAAACTATTCTACTCAATTTCCTGCTAATAATATAATACCCTTAGAAA------------------------CTTCTAATGTGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCAAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTCTTTCATGATCATACTTTAATTATTTTAACTATAATCACCATCTTAGTT-AGTTACATAATAATAAGATTATTTTTT  Niconiades_xanthaphes       

Saturnus_metonidia           ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTCACTGTAATATATTTATTTATCTCTAATTGCTGTTAAATATTAGATTAGTTCTTATCAACATATAGTCTAATATTAAATTAGGATGTATCTCTACAGTTATTAATGAATTAGATCTCATGTATACTCTTGTTCATTTTTATTTTTGATACCAAATATGTTTCGCTGGATATCTAACCATATCAGATTAACTTAAACCCTTACTTATAACTATTTCTATTAGGTATTATTTTA-TCTATCTGATATTACATTTGATAGCATTACTTATACAATTGTTATTTTTATATTAAAAAAAAGATATTGAAAAAATTAATCAATATAATATTTACCCTTTAATAAACTTCTATACTTAACTTATTGCTAATCATATAACACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATTTTCAAAATGCAGCTTCTCCTATAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-ACTTACATAATAATAAGATTA------  Saturnus_metonidia          

Papias_phainis               ---GGACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTTATTTATCACTAATTGCAGTAAAATATTTGATTAGATCTTAACAATATATAGACATATATTAAATTAGGATGTATTTATACAGTAATTAATGAATTAGTTCTCTTGTATACTTATGCTCTTTTATATTTTTGTTACTAAATATGTTTTGCAGGTTATCCAATCTTATCAGATTAACTTAAATCCATATTTATAATTATTTCTATTAGTTATTATCTTA-TCTAATAGTAACATTTTTTGATAGTATCTCTTATACATTTGTTATTTTTATGTAAAAAAAAAGTTACTGAAAAAATTAATCAACGAATTATTTATCCTTTAATAAACTTATATACTTAATCTTTTGCTAACCATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATTTTAATCTTCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGATCACACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGTTTATTTTTT  Papias_phainis              

Vehilius_putus               ATTGGACTTTTAGGATTTATTGTATGAGCTCATCATACATCTACAGTAATATGTGTATTTAACCCTAATTGCTGTTAAATATTTGATTAGTTCTTTCCAATATACAGACTTATATTAAACTAGGATGTATTTATACAGTTAACAAAGAATTAGTTCTCATGTATACTTATGTTCTTTTATACTTTTGTTACTAAATATGTTTTGCAGGATATTCAATCTCATCAGATTAAATTAAATCCATATTTATAATTATTTCTATTAGTTACTATTTTA-TTTATTAGACATAACATTCGATAGTATCTCCTATATATTCATTATTTTTATATTAAAAAAAAAATATTAAATAAATTAATCAACAAATTATTTACCCTTTAATAAGTATATATATTGAATCTGCTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATCCTAATTATAATTACTATTTTAGTT-ACTTATATAATAATAAGTTTATTTTTT  Vehilius_putus              

Cymaenes_alumna              ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTATATATTTATTTTCCTCTAATTGCTGTTAAATATTTGATTAGATCTTTTCAATATATAGACTAATATTAATTTAGGATGTATTTATACAGTAAATAAAGAATCAGTCCTCTTGTATACTCTTGTTCTTTTATATTTTTGACACTAAACATGATTTGCAGGATATTTAATCATATCTGATTAACTTAAATCCATATTTATAATTATTTCTATTAGATATTATTTTA-TTTAGTAGAAGTAACTTTTGATAGTATCTCATATATTATTTTTATTATTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTTACCCTTTAATAAACCTATATACTTAATTTATAGCTAATTATATAATACCTCTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATGGAGCTTCACCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Cymaenes_alumna             

Vidius_catarinae             ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGCATATTATTAATTTATCTCTAATTGCTGTTAAATATTTGATTAGATCTTATCAATATATAGACTAATATTAATTTAGGATGTATTTATCACGTAAATAAAGAATTAGTTCTCTTGTATACTCCTGTTCTTCTATATTTTTGATACTAAATATGTTTTGCAGGATATTTAATCTTATCTGATTAACTTAAATCCATATTTATAATTATTTCAATTAGATATTATTTTA-TTTAATAGGAAAAACTTCTGATAGTATCTCTTATATTATTTTTATCATTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTTATCCTTTAATAAACCTATATACTTAATTTATAGCTAATTACATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTCCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATTTTTTTTCATGA-CATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTT-  Vidius_catarinae            

Mnasilus_allubita            ATTGGACTTTTAGGATTTATTGTATGAGCACATCACATATTTACTGATATATATTTATTCTTCTCTAATTGCAGTAAAATATTTGACTAGATCTTATCAATACATAGACTCATATTAAATTAGGATGTCTTTATACAGTAAATAATGAATTAGTTCTCTTGTATACCCTTGTTCTTTTATATTCCCGTTACTAAATATGTTTCGCAGGATATTTAATCTTATCAGATTAACTTAAATTCATATTTATAATCATTTCAATTAGATATTATTCTA-TTTAATAGATATATTATTTGATAGTACCTCTTATATATTTCTAATTATTACATTAAAAAAAAATTATTGAAAAAATTAATCAACGAATTATTTATCCTTTAATAAACTTTTATACTTAATTTACTGCTAACTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATCTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACTTGATCTAATTTTAACTTCCAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Mnasilus_allubita           

Monca_crispinus              ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTATATATTAACCTTTCTCTAATTGCTGTAATATATTTGATTAGACCTTATCAATATATAGCCTTATATTAATTTAGGATGTATTTATACAGTTAATAAAGAATTAGCTCTCATGTATACTCTTGTTCATTTATGCTTCTGTTACAAAACTCGTTTTGCAGGATATTTAATCTTATCAGATTAACTTAAATCCTTATTTATAATTATTTCTATTAGGTATTACTCTA-TTTAATAGAAATATCATTAGATAGTACCTCTTATATAATTATTATTCTTATTTTAAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTTATTCTTTAACAAAATTATTTACTTAATCTATTGCTAATTATATAATAGGTTTAGAAA------------------------CTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAACCTTAATCTTCAAAATAGAGCCTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Monca_crispinus             

Morys_micythus               ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGATATATATTTATTTATCCCTAATTGCAGTTTAATATTTGATTAGATCTTTACAGTATATAGTCTTATACTAAATTAGGATGTATTTATACAGTAAATAAAGAATTAGTTCCCTTGTATACTCTTGTTCTTTTATATTTTTGTCACTAAATATGTTTTGCTGGATATTTAACCTTATCAGATTAACTTAAATCCTTATTTATAATTATTTCAATTAGATATTACTCTA-TCTAATAGCTATATTTTTTGATAGTATCTCTTATATTTTTCTAATTATTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTTATCCTTTAATAAACTTATATACTTAATCTATCGCAAATTATACAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATCTTAATCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Morys_micythus              

Morys_valda                  ATTGGATTATTAGGATTTATCGTATGAGCCCATCACATATTCACAGAGATATACCAATTTATCTCAAATTGCTGTATGATATTTGATTAGATCTTTTCAATACATAGACCTATATTAAATTAGGATGTTTCTACACAGTAAGCAAAGAATTAGTTCTCTCGTATACTCTTGTTCTTTTATACTTTTGATACTAAACATGTTTTGCTGGATATCTAACCTTATCAGATTAACTTAAACCCTTATTTATAATTATTTCTATTAGGTATTATTCCA-TTTATTAGTTATACCTTTTGATAGCATCTCTTATATTTTTTTTATTATTATATTAAAAAAAAGACATTGAGAAAATTAATCAACGAATTATTTATCCTTTAATAAACTTATATACTTAATTTATTGCAAATTATACAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---ATA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTCCAAAATGGGGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTCTACTTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Morys_valda                 

Mnasicles_hicetaon           ATTGGACTCTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTATATATTTATTTTACTCAAATTGCAGTATAATATTAGATTAGATCTTTACAATATATAGACTAATATTAAATTAGGATGTATTTACACAGTTAACATAGAATTAGTTCTCATGTATACTCTTGTTCTTTTATATTTTTGTTACAAAATATGTTTTGCAGGTTATTTAACCATATCAGATTAACTTAAACCCTTATTTTTAATTATTACTATTTGATATTATTTTA-TTTAATAGTTGTATTTTCTGATAGTATCTCATATATATTTATTATTTTTATATTAAAAAAAAAATATTGAAAAAATTAATCAACGTATTATTCATCCTTTAATAACCATTTTTACTTAATTTATTGCTAATCATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCCAATCTTAATCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACATTAGTTATTTTACTTATAATTACTATTTTAGTT-AGATACATAATAATAAGATTATTTTTT  Mnasicles_hicetaon          

Remella_rita                 ATTGGTCTTCTAGGATTTATTGTATGAGCCCATCATATATTTACAGTAATATATTTATTTTACTCTAATTGCTGTTAAATATTTGATTAGTTCCTATCAATATATAGACTTATATTAAATTAGGGTGTATTTATACAGTAAATAAAGAATTAGTTCTCCTGTATACTCTTGTTCTTTTATATTTTTGCTACTAAATATGTTTTGCAGGATGTTTAATCATATCAGATTAACTTAAGACCTTATTTACAATTATTACTATTTGATATTATTCTA-TTTAGTAGTGATATCTTTTGATAGTATCTCATATGCATTTATTATTTTTATATTAAAAAAAAGACACTGAAAAAATTAATCAACGTATTATTTACCCTTTAATAATCATTTTTACTTAATCTTATGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAACGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAACCTCCAAAATGGAGCTTCTCCATTAATAGAACAAATTATTTTTTTTCATGATCATACATTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Remella_rita                

Amblyscirtes_exoteria        ATTGGACTTTTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGTTATATATTTATTTTACTCTAATTGCAGTAAAATATTAGATTAGTTCTTTTCAATACATAGTCAAATATTAAATTAGGATGTATTTATACAGTAATCATAGAATTAGCCCTCTTGTATACTCTTGTTCCTTTATATTTTTGATACTAAATATGTTTTGCAGGATATTTAATCATATCAGATTAACTTAAGTCCTTATTTATAATTCTTACTATTAGATATTATCCTA-TCTAATAGAAATATTTTTTGATAGTATCTCTTATATATTTATTATTTTTATATTAAAAAAAAAATATTGAAAAGATTAATCAACGTATTATTTATTCATTAATAATCTTTTATACTTAATTTATTGCTAATTATATAGTACCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGATTATTTTTT  Amblyscirtes_exoteria       

Lucida_ranesus               ------------------ATTGTTTGAGCTCATCATATATTTACAGATATATATTAATTTTACTCTAATTGCTGTATCATATTTGATTAGTTCTTTCCAATATACAGACTAATATTAATTTAGGATGTATTTATACTGTAGATGTAGAATTAGTCCCCATGTATACTCTTGTTCATTTATATTTTTGTTACAAAATATGTTTTGCAGGATGAATAATCATATCAGTTTAATTTAAACCCTTACTTATAATTATTTCTATTAGATATTATTCTA-TTTAGTAGAGATTTTTCCAGATAGTACCCCATATATAATTCTTATCCTTATATTAAAAAAAAAACATTGAAATTATTAATCAACGTATTATTCATCCATTAATAGTCATCTATACTTAATTTATTGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTG----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATA------------  Lucida_ranesus              

Cumbre_belli                 ATTGGACTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGATATATATTAATTTTACTCTAATTGCTGTATAATATTTGATTAGTTTATTTCAATATATAGACTTATATTAATTTAGGATGTATTTACACAGTAGATATAGAATTAGTTCCCATGTACACTCTTGTTCTTCTATAATTTTGTCTCTAAGTATGTTTTGCAGGATATTTAATCTTATCAGTTTAACTTAAATTCTTATCTATAATTATTTCCATTAGGTATTATTTTA-TCTAGTAGAAATTTCTTTTGATAGTATCCCTCATATAATTATGATTTTTATATTAAAAAAAAAATATTGAAAAAATTAACCAACGTATTATTTACCCTTTAATAATCATCTATACTTAATTTATTGCTAATTATACAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTAAATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGATATATAATAATAAGTTTATTTTTT  Cumbre_belli                

Caligulana_caligula          -----ACTTTTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTTATCCTACTCTAGTTGCAGTTAAATATTTGATTAGATCTCATCAATATATAGACTAATATTAAATTAGGATGTATTTATACAGTAAATAAAGAATTAGCTCCCACGCATACCCTCGTTCTTTTGTATCTCTGACACTAAGTATGTTTTGCAGGATATTTAATCATATCAGATTAACCTAAATCCTTATCTTCTATTATTTTAATTAGATTTCATTTTA-TTTAATAGATATTTCTTTAGATAGAATCTCATATATAATTATTATTATTATAGTAAAAAAAAAATATTGAAAAAATTTATCAAAATATTATTTACCCCTTAATAAACCTTTTTACTCAATTTACAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAACCTTAATCTTCAAAATAGAGCTTCCCCTTTAATAGAACAAATCATCTTCTTTCACGACCATACTTTAATTATTTTAATTATAATTACTATTTTAATT-AGATATATAATAACAAGATTATTTTTT  Caligulana_caligula         

Hansa_devergens              ATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACAATTATATATTAACTTTACACTAATTGCAGTATAATATTTGATTAGATCTTATCAATATATAGTCTTATATTAAATTAGGATGTATTTATACAGTAAATATAGAATCAGATCTCATGTATACTCTTGTTCTTTTATATTTTTGTTACTAAATATGTTTTGCAGGTTATTTAATCTTATCAGATTAACCTAAATCCCTATCTTCTATTATTTCAATTAGATTTTATTTTA-TTTATTAGACATAACTTTTGATAGCATCTCTTATATAATCATTATTTTTACATTAAAAAAAAAATATTGAAAAAATTTATCAAAATATTATTTATTCTTTAATAATCATTTTTATTAAATCTGATGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAA--ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTT-  Hansa_devergens             

Libra_aligula                ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGAAATATATTAATTTTACTCTAATTGCAGTAAAATATTAGATTAGCTCTTATCAATATATAGTCTAATATTAATTTAGGATGTATTTATACAGTAAATAAAGAATTAGTTCTCTCGTATACTCTTGTTCTTTTATATTTTTGATACCAAATATGATTTGCAGGATATTTAATCTTATCAGATTAACTAAAATCCTTATATACTATTATTTCAATTAGATATTATCTTA-TTTATTAGATATATTATTAGATAGAACCTCTTATATTTTCTTAATCATTATATAAAATAAAAAATATTGAAAAAATTTATCAAAATATTATTTATCCATTAATAATCTTCTTTACTTAATCTTCTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGACAGATATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATCTAAACCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTTTAGTTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Libra_aligula               

Lindra_brasus                -------------------------GAGCTCATCATATATTTACAGTAATACATTTACTTAACTCTAACTGCCGTATAATATTTGATTAGTTCTTACCAGTACATAGTCTTATACTAAATTAGGATGTATTTATACAGTAAATAAAGAATTAGCTCACTTGTGTACTCTTGCTCACTTGTATTCTTGTTACTAAATACGTTTTGCATTATATTTAATCATATCAGATTAACATAAACCCATACTTACTATTATTTCAATTAGATACTATTCTA-TTTAGTAGTCATAATTCTAGATAGTATCTCTTATATATTGTTTATTTCTTTTTAAAAAAAAAAATATTAATAAAATCTACCAAAATATTATTTATCCTCTAATAAACATTTATACTTAATCTTCTGCAAACAATATAATACCTTTAGAAA------------------------CTTCTAATATGGCAGATTACATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACTTGATCTAACTTTAATCTTCAAAATAGAGCCTCTCCTTTAATAGAACAAATTATCTTCTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATCCTAGTT-AGT------------------------  Lindra_brasus               

Amblyscirtes_simius          ATTGGATTACTAGGATTTATTGTTTGAGCCCATCACATATTTACAGTTATATATTAATTTAACTCTAATTGCTGTAAAATATTTGATTAGATCTTATCAATATATAGCCTTATATTAATCTAGGATGTATCTATACAGTATATACGGAATTAGTTCTCATGTATACTTATGTTCATTTATATTTTTGTCTCTAAATATGTCTTGCTGGATATTTAATCTTATCAGATTAACTTAAATCCATATTTATAATTATTTCTATTAGATATTAATCTA-TTTATCAGATATAATTTCAGATAGTATCTCTTATATATTCATAATCATTATATTAAAAAAAAAATATTGAAAAAATTTATCAACGTATTATTCATTCCTTAATAACCCTTTATACTTAATTTAATGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATCTTTTTTCACGATCATACTTTAATTATTCTAATCATAATTACTATTTTAGTT-AGTTATATAATATTAAGATTATTTTTT  Amblyscirtes_simius         

Thespieus_macareus           ---------TTAGGATTTATTGTATGAGCACATCATATATTTACAGATATATATTAATTTTAATCTAATTGCAGTTTATTATTTGATTAGACCTTATCAATATATAGTCTTATATTAATTTAGGATGTATTTATACAGTAGGTATAGAACTAGCTCTCACGTATACTCTTGTTCATTTATATTTTTGATACTAAATATGTTTTGCAGGATATTTAATCTTATCAGATTAACTTAAACCCATATTTATAATTATTTCTATTAGGTATTATTCAA-CTTAATAGTAATATTATTGGATAGTATCTCTTATATATTTATTATTTTTATATTAAAAAAAAAATATTGAAAAAATTTATCAAAATATCATTTATTCCTTAATAACCATTTTTACTTAATCAACTGCAAACTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---AAC----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATCTTAACTTACAAAATAGAGCTTCCCCTTTAATAGAACAAATTATCTTTTTCCATGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGTATAT-----  Thespieus_macareus          

Conga_chydaea                ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATCAATTTAACTCCAATTGCTGTTAAATATTAGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATTTACACAGTAAATACAGAATTAGCTCTCATGTATACTTATGTTCTTTTATATTTTTGCTACGAAATATGTTTCGCAGGATATTTAACCTTATCAGATTAACAAAAATAATTATATATAATTATTTCTATATGATACTAATCCA-TTTATTAGTGATATCCTTAGATAGAATTACTTGAATAATTATTATTTTTATATTAAAAAAAAAATATTAAAAAAATTTATCAAAATATTGTATATTCATTAATAAACATTTTTACTTAATCTATAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGTTTATTTTTT  Conga_chydaea               

Nyctelius_nyctelius          ATTGGATTATTAGGATTTATCGTATGAGCTCATCACATATTTACTGAAATATATTCATTTAACTCTAATTGCCGTAAAATATTTGATTAGATCTCATCAATATATAGACTTATATTAATTTAGGATGTATTTATACTGTAAATATAGAATTAGTCCACATGTATACTCTTGTTCTTTTATATTTCTGTTACTAAATATGTTTTGCAGGATATTCAACCATATCAGATTAACAAAAATAATTATATATAATTATTTCTATATGATATTATTCTA-TTCAATAGGCATAACTTTAGACAGAATTACATGAATAATTATTATTTTTATATTAAAAAAAGAATATTGAATAAATTTATCAAAATATTTCATATTCTTTAATAAACATTTTTACTTAATTCCATGCCAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATCTAAATCTTCAAAACAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-GGTTATATAATAATAAGTTTATTTTTT  Nyctelius_nyctelius         

Pseudocopaeodes_eunus        ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTAATCTACTCAAATTGCTGTATAATATTAGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATCTACACTGTAAATAAAGAGTTAGCTCTCTTGTATACTCTTGTTCTTCTATATTTTTGTTACTAAATATGTTTTGCAGGATATTCAATCATATCAGATTAACAAAAATAATTATTTATAATTATTTCAATATGATATTAATTTA-TTTAATAGTAAAATTATTAGATAGTACTTCATGAATAATTATAATTATTATATAAAAAAAAAAATATTGAAAAAATTTATCAAAATATTGTATATTCTTTAATAAACATTTATACTTAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Pseudocopaeodes_eunus       

Atalopedes_campestris        ATTGGATTATTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGAAATATATTTATTTTACTCTAATTGCAGTTTAATATTTGATTAGAATACTTCAATACATAGCCTCATATTAAATTAGGATGTATTTATACAGTAAATATAGAATTAGTTCACTTGTATACTCTTGTTCATTTATATTCTCGTTACAAAATATGTTTTGCAGGATATTTAATCTTATCAGATTAACAAAAATAATTATATATAATTATTTCAATATGATATTATTTCA-TTTATTAGTAATATTATTTGATAGTATCCCATGAATAATTATTATTTTTATATAAAAAAAAAAATATTGAAAAAATTTATCAAAATATTATTTATTCTCTTATAAACATTTTTACTTAACTTACAGCTACTAATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATCTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATCTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-GGTTACATAATAATAAGACTATTTTTT  Atalopedes_campestris       

Hesperia_leonardus           ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTATATATTTATTTTACTCTAATTGCAGTATAATATTTGATTAGATCTTATCAATATATAGCCTTATATTAAATTAGGATGTATTTATACAGTAAATATAGAATTAGTTCTCATGTATACTCTTGTTCTTTTATTTTTTTGTTACAAAATATGTTTTGCAGGATATTTAACCATATCAGATTACCAAAAATAATTATATATAATTATTTCAATATGATTTTAATCAA-TTTATTAGTAAAATTTCTTGATAGTATCTCATGAATATTTATTATTTTTATATTAAAAAAAAAATATTAAAAAAGTTTATCAAAATATTGTATATTCTTTAATAATCATTTTTACTTAATTTACAACTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGT---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Hesperia_leonardus          

Hylephila_phyleus            ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTAATTTTACTCTAATTGCTGTAAAATATTTGACTAGATCTTATCAATATACAGACTAATATTAAATTAGGATGTATTTATACAGTTAACAAAGAATTAGTTCTCATGTATACTCTTGTTCTTTTATATTCTTGTTACTAAATATGTTTTGCAGGATATTTAACCATATCAGATTAACAAAAATAATTATTTATAATTATTTCAATATGATATTATTTCA-TTCTATAGTTATATCATTAGATAGTATTACATATATACTCATTACCATTATATTAAAGAAAAAATATTGAAAAAATTTATCAAAATATTGTTTATTCATTAATAATCTTTTTTACTTAACTTAAAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAA-ATGGCAACATGATCTAATTTAAATCTTCAAAATGGAGCTTCTCCTTTAATAGAACAAATCATTTTTTTTCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-GGTTATATAATAATAAGTTTATTTTTT  Hylephila_phyleus           

Appia_appia                  ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGAAATATATTTATTTTACTCTAATTGCTGTATAATATTTGATTAGATCTTACCAATATATAGACTTATACTAAATTAGGACGTATTTATACAGTTAATAAAGAGTTAGTTCTCATGTATACATATGTTCATTTATATCTTTGTCAGTAAATATGTTTTGCAGGATATTTAATCATATCAGACTTACAAAAACAATTATTTATAATTATTTCAATATGATATTAACCTA-TTTATTAGTGATATTATTAGATAGTATCTCATGAATATTTATTATTCTTATATAAAAAAAAAAATATTGAAAAAATTTATCAAAATATTGTATATTCTTTAATAATCATTTTTACTTAATCTTTAGCTAATTATATAACACCTTTACAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAACCTTCAAAATAGAGCTTCACCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-GGATATATAATAATAAGTTTATTTTTT  Appia_appia                 

Pompeius_pompeius            ATTGGTCTATTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAATATATGAATTTTTCTCTAATTGCTGTATTATATTTGATTAGATCTTATCAATATACAGACTTATATTAAATTAGGATGTATCTATACAGTTAATAAAGAGTTAGTTCTCATGTGTACTCTTGTTCTTTTTTATTTTTGTTACTAAATATGTTTTGCTGGATATTTAACCTTATCAGACTTACTAAAATAATTATTTATAATTATTTCTATATGATACTAATTCA-TTTATTAGTAAATTTTTTAGATAGTATCCCATGAACAATTATTATTTTTACATAAAAAAAAAAATATTGAAAAAATTTATCAAAATATTGTATATTCTTTAATAATCATTTTTACTTAATCTTCAGCTAATTATATAATACCTTTAGAAA------------------------TTTCTAATATGACAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCCCCTTTAATAGAACAAATTATCTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-GGTTATATAATAATAAGTTTATTTTTT  Pompeius_pompeius           

Polites_themistocles         ATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAATATATTAATTTAACTCTAATTGCTGTATAATATTTGATTAGATCTTATCAATATATAGTCTTATATTAAATTAGGATGTTTTCATACAGTAAATAAAGAGATAGTTCTCATGTATACTCTTGTTCTTTTATATTTTTGCCACTAAATATGTCTTGCAGGATATTTAACCTTATCAGATTAACAAAAATAATTATTTATAATTATTACAATATGATATTAATTTA-TTTAATAGATAAATTTTCAGATAGTATCTCATGAATAATTATTATTATTATATTAAAAAAAAAATATTAAAAAAATTTATCAAAATATTGTATATTCTTTAATAATCATTTTTACTTAATTTAAAGCTAATCATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCATTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTTCATGATCACACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Polites_themistocles        

Stinga_morrisoni             ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGCAATATATTTATTCTACTCTAACTGCTGTAAAATATTTGATTAGATCTTATCAATACATAGACTTATATTAAATTAGGATGTATTTATACAGTATATATAGAATTAGTTCTCATGTATACACTTGTTCTTTTATATTCTTGTTACTAAATATGTCTTGCAGGATATCTAACCATACCAGATTAACTTAAATAATTATTTATAATTATTTCCATATGATATTATTTTA-TTTACCAGTAATAATTTTAGATTGTATCTCTTGAATAATCTTAATTATTATATAAAAAAAAAAATATTAAAAAAATTTATCAAAATATTGTTTACCCATTAATAAACATTTTTACTTAATTTACTGCAAATTATATAATGCCTTTAGAAA------------------------TTTCTAATATGGCAGACTATATGTAATGGATTTAAACCCCACTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTAAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATTATTTTTTTCCATGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGTTTATTTTTT  Stinga_morrisoni            

Ochlodes_sylvanoides         ATTGGACTATTAGGATTTATTGGCTGAGCTGGTCATATATTTACAGTTATATATTAATTTTACTCTAATTGCAGTAAAATATTTGATTAGATCTTATCAATATATAGTCCAATATTAAATTAGGACGTATTTATACAGTAAACATAGAATTAGATCTCCTGCATACACTTGTTCTTTTATATTTTTGTTACTAAATATGTTTTGCAGGATATCTAACCATATCAGATTAACTTAAATGATTTTTTATGATTATTACTATATGATATTATTCTA-TCTATTAGATATATCTTTAGATAGTATCTCTTGAATAATTATTATTACTATATTAAAAAAAAAATATTAAAAAAATTTGTCAAAATATTGTTTATTCTTTAATAAACATCTTTACTTAATTTATAGCTAATTATATAATACCTTTAGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------  Ochlodes_sylvanoides        

Poanes_taxiles               ATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAATATATTTATTTTACTCTAATTGCTGTAAAATATTTGATTAGATCTTATCAATATATAGACTTATATTAAATTAGGATGTATTTATACAGTAAATATAGAATTAGTTCACATGTACACTCTTGTTCATTTATATTTTTGTTACTAAATATGTTTTGCAGGATATTTAACCTTATCAGATTAACTTAAATAATTACTTATAATTATTTCTATATGATATTATTTTA-CTTATTAGAAATAATATTAGATAGTATCTCTTGAATAATTATTATTATTATATAAAAAAAAAAATATTATAAAAATTTATCAAAATATTGTATATTCTTTAATAAACATTTTTACTTAATTTATTGCTAATAATATAATACCTTTAGAAA------------------------TTTCTAATATGGCAGATTATATGTAATGGATTTAAACCCCACTTATAAAGGA---TTA----TCCTTTTTTTAGAAT-ATGGCAACATGATCTAATTTTAATCTTCAAAATAGAGCTTCTCCTTTAATAGAACAAATCATTTTTTTTCACGATCATACTTTAATTATTTTAATTATAATTACTATTTTAGTT-AGTTATATAATAATAAGATTATTTTTT  Poanes_taxiles              

 


Multiple sequence alignment of EF1α gene. Species order is like in the tree above. Most frequent nucleotide in each position is not highlighted, Second, third and forth most frequent are highlighted red, green and cyan, respectively. Missing data and deletions (gaps shown as dashes) are highlighted in gray. Black highlight indicates some interesting positions that may unify certain groups. Yellow highlights the most special position that divides all the skippers in two groups: "true" Hesperiini and the rest. Giant-skipper sequences are underlined.

Badamia_exclamationis        GGATCGGTTACAACCCCGCTGCTGTCGCGTAACTCCCGACCCGGGCCACCCCATCCCGATTTGGTGYGGACGGCTATATCCCATCGCGCATCCGCCTTCCAGCCCCCTCTCCCGGACACTCCTTAAGTGCGGCCTCATTGCCSAGCTCTTCTCGTCCCCTATAAGTCGGGACCATCCAAGGCTTGCACCTTCCAGCCCCGGTGGTTYTACTCTTACCCRCACGTCGCGCCAACGCAACTGCCCYGGTACCCCCGCGGCGTCCTCTCCGCAGGCAGGCACTTATTCAGAGCCCAATCACGTTTGCCTGCAACCTGGTACCCTCCAAGCCCCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Badamia_exclamationis     

Bibasis_sena                 GGATCGGTTACAACCCCGCTGCTGTCGCATAACTCCCGACCCGGGCCACTCCATCTCGATTTGGTGTGGATGGCCACGTCCTGTTGCGCATCCGCGCTCCAGCCCCCTCTCCCGGACACTCTTTTAGTGCGACAATATTGCCCAGTTCTTCCCGTCCCCTAAAAGTTGGGACCATCCAAGGCTTGCACTTTCCAGCCTCGATGGTTCTACTCCAACCCGCACGTCGAGCCAACACAGCTGTCCTGGTATCCTCAAGGTGTCCTCTCCGCAGACAGGTACTTATTTTGAGTCCAATGATATCTGCCTGCAACCTCGTGCCCTCCAAGCCTCTGTGCGTAGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTCGCC  Bibasis_sena              

Burara_aquilina              AGATCGGTTACAACCCTGCTGCTGTCGCGTAACTTCCGACCCGGGCCACTCCATCTCGATATGGTGCGGGCGGCCACGTCCCATTGCGCATCCGCGTTCCAGGCCCCTCTCCCGGACCCTCTTTTAGTGAGGCAATATTGCCGAACTCTTCTCATCCCCTACAAGTCGGGACCACCCAAGGCTTGTATCTTCCAGCACCGATGGTTATACTCCTACCCGCACGTCGAGCCAACACAGCCGTTCTGGTATCCCCATGGTGTCTTCTCCGCAGACAGGTACTTATTCTGAGTTCAATAACAATTGCCTGCAACCTCGTGCCCTCCAAGCCTCTGTGCGTGGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTCGCC  Burara_aquilina           

Choaspes_stigmata            AGATCGGTTACAACCCCGCTGCTGTCGCGTTACTCCCGACCTGGGCCACCCCATCCCGATAATGCGCGGAAGGCTATATCCTATTGCGCATCCGCGTTCCAGCCCCCTCTCCCGGACACTCTTTTAGTGCGACAATATTACCCAACTCTTCTCGCCCCCTAAAAGTCGGGACCACCCAAGGCTTCCACTTTCCTGCCTCGATGGTTGTACTCTTACCCGCACGTCGAGCCAACACAGCTGTCCTGGAACCCCCGCGGTGTCCTCTCCGCAGGCAGGTACTTATTCTGGGCTTAATCACATTTGCCTGCAACCTCGTGCCCTCCAAGCCCCTGTGCGTGGAGTCCTTCCAGGAATTCCCACCCCTCGGTCGGTTCGCC  Choaspes_stigmata         

Coeliades_forestan           GGATCGGTTACAACCCCGCTGCTGTCGCGTTACTCCCGACCCGGGCCACCCCATCCCGATTTGGTGCGGAAGGCCATATCCTATTGCGCATCCGCGTTCCAGGCCCCTCTCCCGGACCCTCTTTTGGAGCGACAATATTGCCCAACTCTTCTCGCCCCCTAYAAGTTGGGACCACCCAAGGCTTCCACCCTCCTGCCCCGATGGTTTTACTCTTACCCGCACGTCGAGCCAACGCAGCCGTCCCGGAACCCACAAGGTGTCCTCTCCGCAGGCAGGTACTTATTTTGAGCTCAATCACGTTTGCCTGCAACCTCGTGCCCTCCAAGCCTCTGTGCGTGGAGTCCTTCCAGGAATTCCCACCCCTCGGTCGTTTCGCC  Coeliades_forestan        

Hasora_khoda                 GGATCGGTTACAACCCCGCTGCTGTCGCGTAAGTCCCGACCCGGGCCACCCCACCCCGATTTGGTGCGGACGGCTACGTCCTACTGCGCATCCGATATACAGGTCGCTCTGCCGGACCCTCTTTTAGTGCGACAACATCGCCCAGCTCTCGCCGCCCCCTATAAGTCGGGACCATCCAAGGCTTGCACTATCCTGCCCCGATGGTTCTACTCTTACCCGCACGTCTAGCCAACACAGCCGTCCTGGTACCCCCGTGGCGTCCTCTCCGCAGACAGGGACTTATTCTGAGCCTAATATCGTTTGTCTGCAACCTAGTACCCTCCAAGCCCCTGTGTGTGGAGTCCTTCCAGGAATTCCCACCCCTCGGTCG-------  Hasora_khoda              

Euschemon_rafflesia          -AATCGGATACAACCCAGCTGCTGTTGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAATGTGCGGATGGCGACATCTTGCTGCGCATCCGCATTGCAAGCCCCCCTCCCTGATTCTTTTTTAGTGCGACAATGTTACCCAGATCTTGTGTCCCCCTAAAAGTTCGGACCGTTCAAGGCTTTCACTTTCTTGCCTTGACGGTTATATTTTCATCTGCACGTCTTGCCACCACAGCTACCCTGGTATCTTCGTGGTGTCTTCTCCGTAGGCAGATACTTATTAAGAGATCAGTCACGTTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGCGTGGAGTCCTTCCAAGAGTTCCCACCCCTTGGACGATTT---  Euschemon_rafflesia       

Dyscophellus_phraxanor       GAATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGCGGATAGCTACGTCCTGTTGTGCATCCGCTCGTTAGCCCCCTCTCCCGGACCCTATTTTAGTGTGATAATGTTACCCAGTTCTTATCTTCCCCTAAAAATTGGGACCATCCAAGGCTTGTACTTTCCAGCATTGATAGTTCTATTTTTACCCGCACGTCGTGCCATCTCAGCCCTCTCGGTATCCTCATGGTGTCTTCTACATAGAAAGATACTTATTATGGGGTTAATAACATTCGTCTGTAACCTAGTGCCCTCCAAACCTCTGTGCGTAGAGTCTTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Dyscophellus_phraxanor    

Cogia_calchas                GAATTGGATACAACCCAGCTGCCGTCGCGTAACTCCCGACCTAGGCCACCCYATCTCGATAATGTGTGGATGGCTACGTCCTATTGTGTATCCGCTCTTCAGCCCCCTCTCCCGGACTCTTCTTTAGTGCGACAATATTGCCCAGTTCTTATCTACCCCTAAAAATTGGGACCGTCCAAGGCTTGTACTTTCCAGCTTTGATGGTTCTATTTTTACCGGCACGTCGCGCCATCACAACCGCCCTGGTATCCTCATGATGTCTTCTCTACAGACAAGTACTTATTATGGGGTCAATTACGTTTGTCTGTAACCTAGTACCCACAAAACCCCTGTGTGTAGAGTCCTTCCAGGAATTCCCACCCCTTGGTCGTTTTGCC  Cogia_calchas             

Phocides_lilea               GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGCGGATGGCTAAGTCCTGTTGCGCATCCGCTCTGCAGCCCCCTCTCCCGGACTCTCTTTTAGTGCGACAAGATTACCCAGTTCTTATCTTCCCCTACAAATTAGGACCGTCCAAGGCTTGTACTTTCCCGCATCGATAGTTCTATTTTTACCCGCACGTCGTGCCAACACAGCTGTCCTGGTATCCTTATGTTGTCTTCTCCACAGACAGGTACTTATTCTGGGGTTAGTAACGTTTGTCTGTAACCTAGTACCCTCCAAGCCTTTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGGTTCGCT  Phocides_lilea            

Nascus_paulliniae            GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCGCCCTATCTCGATAATGTGCGGATGGCTACGTTCTGCTGCGTATCCGCTCTTCAGCCCCCTCTCTCGGACTCTCTTCTAGTGCGACAAGATTACCCAGTTCTCATCTTCCCCTATAAATTTGGACCGTCCAAGGCTTGTACCTTCCAGCATCGATGGTTCTATTTTCACCCGCACGTCGTGCCAACACAGCTGTCCTGGTATCCTCACGATGTCTTTTCCGTAGACAGGTACTTATTCTGGGATTAATTACGTTCGTCTGTAATCTAGTACCCTCCAAGCCTTTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGGTTCGCC  Nascus_paulliniae         

Udranomia_kikkawai           GAATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCTCGATAATGTGTAGATGGCTACATCCTGTTGCGCATCTGCCTTTCAGCCCTCTCTCCCGGACCCTCTTTTAGTGAGACAATGTTACCCAACTCTTATCTTCCCATAAAAATCTGAACCATCCAAGGCTTGTACTGCCCAGCATCGATGGTTCTACTCATACCCGCACGTCGTGTCATCACAACTGCCCTGGTATCCTCATGGTGTCCTTTCCACAGACAGGTACTTATTCTGAGCTTAATAATGTTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Udranomia_kikkawai        

Drephalys_kidonoi            GAATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCTGACCTGGGCCACTCAATCTCGATAATGTGTGGATGGCTACGTCCTGTTGCGCATCTGCTCTTCAGCCCCCTCTCCCCGACCCTTTTTTAGTGTGACAATACTACCCAGTTCTTATATTCCCCTAAAAGTTTGGACCGTCCAAGGCTTGTACTTACCAGCATCGATGGTTCTATTTTTACCCGCACGTCGTGCCATCACAGCCGCCCTGGTATACTCATGCTGTTTTTTCCAYAGACAGATACTTATTCTGGGGTTAATGATGTTTGTCTGTAACCTAGTACCCTCCAAACCTCTGTGTGTGGAGTCCTTCCAGGAATTCCCACCTCTTGGTCGTTTCGCT  Drephalys_kidonoi         

Hyalothyrus_mimcus           -GATTGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACTCCGTCTCGATAACGTGCGGATGGCTACGTCCTGTTGTGCATCCTCTCTTCAGCCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATATTGCCCAGTTCTTATCCCCCTCTAAAAATCAGAACCATCCAAGGCTTGTACTTTCCAGCATAGATGGTTGTACTCTTACCCGCACGTCGTGCCACCACAGCCCCCCTGGTATCCTCATGATGTCTTCTCCGCAGACAGGTACTTATTTTGGGTTTAATGACGTTTGTCTGTAACCTAGTTCCCTCTAAGCCACTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Hyalothyrus_mimcus        

Bungalotis_erythus           GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGCGTGGATGGCTACGTCCTGTTGTGCATCCGCTTTCTAGCCCCCTCTCCCGGACCCTCTTTTAGTGAGACAATGTTACCCAGATCTTACCCACCCCTATAAGTTGGGACCGTCCAAGGCTTGTACCTTCCTGCATCGATGGTTCTATTCTTACCCGCACGTCGTGCCATCACAGCCGTCTTGGTATCTCCATGGTGTCTTCTCTACAGACAGGTACTTATTCTGGGGTTAATAACGTTTGTCTGAAACCTAGTACCCTCCAAGCCTCTGTGCGTAGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTTGCC  Bungalotis_erythus         

Ocyba_calathana              GAATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGTGGATGGCTAAGTCCTGTTGTGCATCCCCGCTTTAGCCCGCTCTCCCGGACCCTCTTTTAGTGCGACAATATTACCCAGTTCTTATCTTCCCCTATAAGTCGGGACCGTCCAAGGCTTGTACCTTCTAGCATCGATGGTTCTACTTTTACCCGCACGTMGTGTCATCACAGCCGCCCTGGTATCTTCRTGATGTTCTCTCCACAGACAGGTACTTATTCTGGGGTTAATGACGTTTGTCTGTAACTTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Ocyba_calathana           

Polygonus_leo                GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGCGTAGATGGCTACGTCCTGTTGCGCATCCGCTCTTCAGCCCCCTCTCCCGGACACTCTTTTAGTGCGACAATGTTACCCAGTTCTTACCTTCCCTTAAAAATCGGGACCGTCCAAGGCTTGTACCTTCCAGCATCGATGGTTCTAYTCTTACCAGCACGACGCGCCAYCACAGACGTCCCGGTATCTTCATGGTGTCTCCTCCGCAGACAGGTACTTATTATGGGGTCAATTACGTTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCTCCCCTTGGTCGTTTCGCC  Polygonus_leo             

Telemiades_fides             GAATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAATGTGTGGATGGCTACGTCCTATTGCGCATCCGCTCTTCAGCCCCCTCTCCCGGACACTCTTTTAGTGCGACAATGTTACCCAGTTCTTATCTTCCCTTAAAAATCGGGACCGTCCAAGGCTTGTACTTTCCAGCATCGATGGTTTTATTCTTACCAGCACGTTGTGCCATCACAGACGTCCTGGTATCCTCACGATGTCTTCTCCGTAGACAGGTACTTATTATGGGGTTAGTAACGTTTGTCTGTAACCTAGTACCTTCCAAGCCTTTGTGCGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Telemiades_fides          

Proteides_mercurius          -AATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGCGGAAGGCTACGTCCTGYTGCGCATCCGCCCTTTAGGCCGCTCTCCCGGACACTCTTTTAGTGCGACCTTATTACCCAGTTCTTATCCTCCCCTAAAAATCGGGACCGTCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTATTTTYACCCGCACGTYGTGCCACCACAGCCGCCCTGGTATCCCCATGATGTCTTCTCCACAGGCAGGTACTTATTCTGAGGCGAATAACATTTGTCCGTAACCTAGTGCCCTCTAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGC-  Proteides_mercurius       

Chioides_catillus            GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGTGGATGGCTACGTCCTGTCGCGCATCCGCCCTTTAGGCCGCTCTCCCGGACTCTCTTTTAGTGCGACCTTGCTACCCAGTTCTTATCCTCCCCTAAAAATCGGGACCGTCCAAGGCTTGTACTTTCCAGCATTGATGGTTCTACTTCTACCCGCACGTCGTGCCACCACAGCCGCYCTGGTACCYCCATGGTGTCCTCTCCACAGACAGGTACTTATTTTGGGGCCAATAACATTTGTCTGTAACCTAGTGCCCTCCAAGCCTCTGTGCGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGC-  Chioides_catillus         

Spathilepia_clonius          -AATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGTGGATGGCTACGTCCCGTTGCGCATCCGCTCTTTGGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACAATATTACCCAGTTCTTATCCTCCCCTAAAAATTGGGACCATCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTAYTCCTACCCGCACGTCGTGCCACCACAGCCGCCCTGGTATCYCCATGGTGTCTTCTCCACAGACAGGTACTTATTCTGGGGCGAATAACGTATGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTAGAGTCTTTCCAGGAGTTCCCACCCCTCGGTCGTTTTGC-  Spathilepia_clonius       

Urbanus_dorantes             GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAACGTGTGAATGGCTACATCCTGTTGCGCATCCGCCCTTCAGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACCTCATCACCCAGTTCTTACCATCCCCTACAAGTAGGGACCGTCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTACTTCTACCCGCACGTCGCGCCACCACAGCCGCCCCGGTATCCTCACGGTGTCTTCTCCACAGACAGGTACTTATTTTGAGGCGAATAACGTTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCG-------  Urbanus_dorantes          

Thorybes_pylades             -AATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGTGGATGGCTACGTCCTGTTGCGCATCCGCTCTTCAGGCCGCTCTCCCAGACCCTCTTTTAGTGCGACCTCATCACCTAGTTCTTACCCTCCCCTATAAGTAGGGACCATCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTACTTCTACCCGCACGTCGCGCCACCACAGCCGCCCCGGTATCCTCACGTTGTCTTCTCCACAGACAGGTACTTATTATGAGGCGAATAACGTTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCTTCGGTCGTT-----  Thorybes_pylades          

Autochton_longipennis        -AATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAATGTGTAGATGGCTACGTCCTGTTGCGCATCCGCTCTTCAGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACCTTATTACCCAGTTCTTACCTTCCCCTATAAGTRGGGACCGTCCAAGGCTTGTACTTTCTAGCCTTGATGGTTCTACTTCTACCCGCACGTCGTGCCATCACAACCGCCCTGGTATCCTCACGGTGTCTTCTTCACAGACAGGTACTTATTTTGAGACAAATAATGTTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCG  Autochton_longipennis     

Achalarus_albociliatus       -AATCGGTTATAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGTGGATGGCTAAGTCCTGTTGCGCATCCGCCTTTCAGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACCTCATCACCCAGTTCTTACCCTCCCCTACAAGTAGGGACCGTCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTACTTCTACCCGCACGTCGTGCCACCACAGCCGCCCYGGTATCCTCACGGTGTCTTCTCCACAGACAGGTACTTATTTTGAGGCGAATCACGTTTGTCCGTAACCTAGTACCCTCCAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTCGC-  Achalarus_albociliatus    

Urbanus_simplicius           -AATCGGTTACAACCCAGCTGCAGTCGCGTAACTACCGACCTGGGCCACTCCATCCCGATAACGTGTGGATGGCTACGTCCTGTTGCGCATCCGCTCTTCAGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACCTTATCACCCAGTTCTTATCCTCCCCTATAAGAGGGGACCGTCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTACTTTTACCCGCACGTCGTGCCAYACACGCCGCCCTGGTATCCTCATGATGTCTTCTCCACAGACAGGTACTTATTTTGAGGCGAATAACGTTTGTCTGAAACCTAGTACCTTCCAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCCTCGGTC--------  Urbanus_simplicius        

Astraptes_fulgerator         -AATCGGATACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGTAGATGGCTACGTCCTGTTGCGCATCCGCTCTTCAGGCCGCTCTCCCGGACCCTCTTTTAGTGAGACCTTATTACCYAGTTCTTATCTTCCCCTAYAAATTGGGACCGTCCAAGGCTTGTACWTTCYAGCCTTGATGGTTCTAYTTCTACCCGCACGTCGYGCCACCACAGCCGCCCTGGTATCCTCATGGTGTCTTCTCCACAGACAGGTACTTATTTTGAGGCGAATAACGTTTGTCTGTAACCTAGTGCCCTCCAAGCCTCTGTGTGTAGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTCGC  Astraptes_fulgerator      

Narcosius_colossus           GGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAATGTGTGGATGGCTACGTCCCGCTGCGAATCCGCTCTTTAGGCCGCTCTCCCGGACCCTCTTTTAGTGCGACCTTATTACCCAATTCCCATCCTCCCCTAAAAATTGGGACCGTCCAAGGCTTGTTCTTTCCAGCCTTGATGGTTCTAYTCCTACCCGCATGTYGCGCCATCACAGCCGCCCTGGTACCCTCGTGGTGTCTTCTCCACAGACAGGAACTTATTCTGGGGCGAATAACGTTTGTCCGCAACCTAGTACCCTCCAAGCCCCTGTGCGTAGAGTCTTTCCAGGAGTTCCCACCCCTCGGTCGTTTTGCC  Narcosius_colossus        

Cabares_potrillo             GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGTGGATGGCTACGTCCTGCTGCGCATCCGCTYTTCAGGCCCCTCTCCCGGACCCTCTTTTAGTGCGACCATATTACCCAGTTCTTATCCTCCCCTAAAAGTCGGGACCGTCCAAGGCTTGTACTTTCCAGCCTTGATGGTTCTACTTCTACCCGCACGTCGTGCCACCACAGCCGCCCTGGTATCTTCATGGTGTCTTCTCCACAGACAAGTACTTATTATGAGGCGAATAACGTTTGTCTGTAACCTAGTACCCTCTAAGCCTCTCTGCGTAGAGTCTTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Cabares_potrillo          

Aguna_asander                GGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCTCGACCTGGGCCACCCCATCCCGATAACGTGYGGATGGCTACGTCCCGTCGCGCATCCGCTCTTTAGGCCTCTCTCCCGGACCCTCTTTTAGTGCGACCTTATTACCTAACTCTTATCCTCCCCTATAAATTGGGACCGTCCAAGGCTTGTACTTTCCAGCATCGATGGTTCTACTTTTACCCGCACGTCGTGCCACCACAGCCGCCCCGGTATCCTCACGGTGTCCTCTCCACAGACAGGCACTTATTCTGGGACGAATCACGTTTGTCTGTAACCTAGTACCCTCCAAGCCCCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTCGCC  Aguna_asander             

Typhedanus_ampyx             -AATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGTGGATGGCTACGTCCTGTTGCGTATCCACTCTTCAGGCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATATTGCCCAGTTCTTATCTCCCCCTATAAGTTGGGACCGTCCAAGGCTTGTACTTTCCAGCTTTGATGGTTCTATTTTTACCCGCACGTCGTGCCATCACAGCCGCCCTGGTATCCTCATGGTGTCTTCTCCATAGACAGGTACTTATTATGGGGCCAATTACGTTTGTCTGTAACTTAGTACCTACAAAGCCTCTGTGTGTGGAGTCCTTCCAGGAATTCCCACCCCTTGGTCGTTTTGCT  Typhedanus_ampyx          

Codatractus_melon            --ATCGGTTACAACCCAGCTGCCGTTGCGTAACTCCCGACCTGGGCCACTCCATCTCGATAACGTGCGGACGGCTACGTCCTATTGTGCATCCGCTCTTTAGGCCTCTCTCCCGGACCCTCTTTTAGTGCGACAATATTACCCAGTTCTTATCCTCCCCAAAAAATTGGGATCGTCCAAGGCTTGTATCTTCCAGCATCGATGGTTCTACTCTTACCCGCACGTCGTGCCATCACAGCCGGCCTGGTATACTCGTGATGTCCTCTCCACCGACGGGTACTTATTCTGGGGCAAATCACGTTTGTCTGTAACCTAGTACCCTCAAAGCCCCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCC---------------  Codatractus_melon         

Zestusa_elwesi               GGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACTTGGGCCACAACATCCCGATAATGTGCGGAAGGGTACRTCCTGTTGCGCATCCGCTCTTTAGGCCTCTCTCCCGGACCCTCTTTTAGTGCGACAATATTACCCAGTTCTTATCTTCCCCTAAAAATTAGGACCRTCCAAGGCTTGTACTTTCCAGCATTGATGGTTCTATTTTTACCCGCACGTCGTGCCATCACAGTCGCCCCGGTACCTTCGTGGTGTCACCTCCACAGACAAATACTTACTATGGGGCGAATCACGTTTGTCTGTAACCTAGTACCCTCAAAGCCCCTGTGTGTTGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCC  Zestusa_elwesi            

Lobocla_liliana              GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGCGGACGGCTACGTCTTGTTGYGCATCCGCTCATTAGGCCCCTCTCCCGGAYCCTCTTTTAGTGCGACAAAATTACCCAGTTCTTATCCTCCCCTAAAAATTTGGACCGTCCAAGGCTTGTACTTTCCAGCATCGATGGTTCTATTTTTACCCGCACGTYGTGCCATCACAGCAGCCCTGGTATCCTCGTGGTGTCTTYTCYACAGACGGGGACTTATTAAGGGACGAATCACGTTTGTCTGTAACTTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTTGCT  Lobocla_liliana           

Calliades_zeutus             GAATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCTATCCCGATAACGTGCGGAAGGCTACGTCCTATTGCGCATCCGCTCTTTAGGCCTCTCTCCCGGACCCTCTTTTAGTGCGACAATATTACCCAGTTCTTACCATCCCCTAAAAATTGGGACCGTCCAAGGCTTGTACTTTCCAGCATCGATGGTTCTATTTTTACCCGCACGTCGCGCCATCACAGTCGCCCTGGCATCCTCATGGTGTCTTCTCCACAGACAGGTATTTATTCTGGGGCGAATCACGTTTGTCTGTAACCTAGTACCCACCAAGCCCCTATGTGTTGAGTCCTTCCAGGAGTTCCCACCTCTTGGTCGTTTCGCC  Calliades_zeutus          

Apyrrothrix_araxes           GGATTGGTTACAACCCGGCTGCCGTTGCGTAACTCCTGACCTGGGCCACAACATCACGATAATGTCTGGATGGCTACGTCGTACTGCGCATCCGCCATCTCGCCCTCCCTCTCGGACCCTTTTTAAGTGCGACCAGGTTACCGAATTCTTATTTTCCCATAAAAATTAGGACCATTCAAGGCTTGTACTTTCCAGCAGGGATGGTTCTATTTTTATCCGCATGTCGTGTCATCACAACTGTCCTGGTATCTTCATGATGTCATCTCTATAGACAGGTACTTATCAAGAGATCATGAACATTTGTCTGTAACTTAGTACCTTCTAAGCCTCTGTGTGTGGAGTCCTTCCAAGAGTTCCCACCCCTTGGTCGTTTCGCT  Apyrrothrix_araxes        

Creonpyge_creon              GGATTGGTTACAACCCGGCTGCCGTCGCGTAACTCCTGACCTGGGCCACAACATCTCGATTATGTGTGGATGACTACGTCGTACTGCGCATCCTCCATCTCGCCCTCCCTCCCGGACCCTTTCTAAGTGCGACAAGGTTACCGAATTCTTATTTTCCCATAAAAATTAGGACTATTCAAGGCTTGTACTTTCTAGCGGGGATGGTTCATATTTTACCCACATGTCGTGCCATCACAACTGTCCTGGTATCTTCATGATGTCATCTCTATAGACAGGTACTTATCAAGAGATCGTGAACATYTGTCTGTAACTTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAAGAGTTCCCACCCCTTGGTCGTTTCGCT  Creonpyge_creon           

Pyrrhopyge_zenodorus         GGATTGGTTACAATCCGGCTGCCGTCGCGTAACTCCCGACTTGGGCCACACCATCTCGATGCTGTCTAGATGGCTACGTCGTGCTGCGCATCCGCTATCTCGCCCTCCCTCCCGAACCCTTTTTAAGTGCGACAAGGTTACTGAGTTCTTATTTTCCCATAAAAATTGGGACTATTCAAGGCTTGTACTTTCCAGCGTGGATGGCTATACTTATACCCGCCTGTTGTGCCATCACAACTGTCCTGGTATCTTCATGATGTCATCTTTACAGATGGGTACTTATCAAGACATCATGAACGTTCGTCTGTAACTTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAAGAATTCCCACCCCTTGGTCGTTTCGCT  Pyrrhopyge_zenodorus      

Mysoria_ambigua              GAATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTCTGGATGGCTACGTCGTACTGTGTATCCTCCTTCTCGCCCTCTCTCCCGGACCCTTTTTAAGTGCGCCAAGGTTACCGAATTCTTATTTTCTCTTATAAATTGGGACCATTTCAGGCTTGTACCTTCCAGCATGGATGGTTCTATTTTTACCCGCATGTCGTGCCACCACAAATGTCCCGGTATCTTCATGATGTCATCTCTATAGACAGGTACTTATCAAGAGATCATGTACATTTGTCTGTAACTTAGTACCTTCTAAGCCTCTATGTGTGGAGTCCTTCCAAGAATTCCCACCCCTCGGTCGT------  Mysoria_ambigua           

Sarbia_xanthippe             GAATTGGTTACAACCCAGCTGCCGTCGCGCAACTCCTGACCTGGGCCACAACATCTCGTAAATGTCTGGATGGCTACGTCGTACTGTGCATCCGCCTTCTCGCCCTCCCTCCCGGACCCTTTTTAAGTGCGCCAAGGTTACCGAATTCTTATTTTCTCATATAAATCGGGACCATTCAAGGCTTGTACCTTTCTGCGTTGATGGTTCTATTTTTACCCGCATGTCGTGCCATCACAACTGTCCTGGTATCTTCATGATGTCATCTCTATAGACAGGTACTTATCAAGAGATCATGAATATTTGTCTGTAACT-----------------------------------------------------------------  Sarbia_xanthippe          

Elbella_scylla               GGATCGGTTACAATCCGGCTGCCGTTGCGTAACTCCTGACTTGGGCCACACCATCTCGATAATGTGTGGATGGCTACATCGTACTGCGCATCCGCCATCTTGCCCTCCCTCTCAGACCCTTTTTAAGTGCGACAAGGTTACTGAATTCTTATTTTCCCATAAAAATTGGGACTATTTCAGGCTTGTACTTTCTAGCATGGATGGTTCTATTTTTACCCGCACGTCGTGCCATCACAACTGTCCTGGTATCTTCATGATGTCATCTCTATAGACAGGTACTTAACAAGAGATCATGAACATCTGTCTGTAACTTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Elbella_scylla            

Parelbella_macleannani       GGATCGGTTACAATCCGGCTGCCGTCGCGTAACTCCTGACCTGGGCCACACCATCTTGATAATGTGTGGATGGCTACGTTGTACTGCGCATCCTCCATCTCGCCCTCCCTCCCGGACCCTTTTTAAGTGCGACAAGGTTACCGAATTCTTATTTTCCCATACAAATTGGGACCATTCAAGGCTTGTACTTTCTAGTATAGATGGTTCTATTTCTACCCGCACGTCGTGCCATCACAACTGTCCTGGTATACTCACGACGTCATCACTATAGAAAGGTACTTATCAAGAGATCATGAACATATGTCTGTAACTTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTCGGTCGTTTCGCT  Parelbella_macleannani    

Passova_gellias              GGATTGGTTACAACCCGGCAGCCGTCGCGTAACTCCCGACCCGGGCCACTCCATCCCGATAATGAGTGGATGGCTACGTCTTGTCGCGCATCTGCCGTCTAGCCCCCTCTCCCGGACCCTCTTCAGGTGCGCCAAGATTACCGAGCTCTAATTTTCCCATATAAGTTGGGACCATGCAAGGCTTGCACTTTCCAGCTTTGATGGTTATATTTTTACCAGCGCGTCGTGCCATCACAATTGCCCTGGTATCCTCGCGATGTCATCCCCATCGACAGGGACCTATCGTGAGATCATGAACACCCGCCTGCAACCTTGTGCCCTCCAAGCCTCTG---------------------------------------------  Passova_gellias           

Myscelus_belti               GGATCGGTTACAACCCGGCTGCCGTCGCGTAACTCCCGACCCGGGCCACTCCATCCCGATAATGAGTAGATGGCTACGTCTTGTCGTGCATCTGCCGTCTAGCCCCCTCTCCCGGACCCTTTTCAGGTGCGATAAGATTACCGAGTTCTAATTTTCCCATAAAAATTGGGACCGTGCAAGGCTTGCACTTTCCAGCTTTGGTGGTTATATTTTTACCAGCACGCCGTGCCATCACAGTTGTCCTGGTATCCTCACGATGTCATCCCTATCGACAGGAACCTATTGTGAGATCATGAACACCCGCCTGTAACCTTGTACCTTCCAAGCCTCTGTGTGTGGAATCTTTCCAGGAATTCCCTCCCCTTGGTCGTTTCGCC  Myscelus_belti            

Netrocoryne_repanda          GGATTGGTTACAACCCAGCAGCCGTCGCGTAACTCCCGACCTGGGCCACCCTATCTCAATAATGTGCGGATGGCTACATCGCGCCACGCTACCCCCTTTTGGGCTCCTCTCCCGGACCCTATTTTAGTAAGACAATACCACCGAATCCTTGTCATCTCCTATAAATTGGGACCGTTCAAGGCTTGCACTTTCCAGCTTCGATGGTTCTATTCTTACCCGCACGTCGCGCCATCGCAGCTGCCCTGGTATGCTCACGGTGTCATCTCCACTGACAGGTACTTATTCAGGGGTCAATTACATTTGTCTGTAATCTAGTACCTTCCAAGCCTCTATGTGTGGAGTCCTTCCAGGAATTCCCACCTCTTGGTCGTTTCGCT  Netrocoryne_repanda       

Tagiades_flesus              -------TTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCACGATAACGTGCGGATGGCTACGTCGTGTCGTGTATCCTCCTTCCAGGCTCCTCTCTCGGACCCTCTTCAGGTGAGGCAATATTACCGAGCTCTTGCTCCCCCCTACAAGTTGGGACCATCCAAGGCTTGTACCTTCCCGCTCCGATGGTTTTAYTCCTACCCGCACGTCGTGCCAACACAGCCGCCCTGGTATCCCCAAGGTGTCATCTCCACCGACAGGCACTTATTCTGAGCTCAGTTACATTTGCCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAATTCCCTCCTCTCGGTCGTTTCGC-  Tagiades_flesus           

Daimio_tethys                GGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCACGATAACGTGCGGATGGCTACGTCGTGTCTTGCATCCTCCCTCCAGGCTCCTGTCCCGGACCCTCTTTAGGTAAGGCAATATTACCGAGTTCTTGCTTTTCCCTACAAGTTGGGACCGTCCAAGGCTTGTACCTTCCAGCTCCGATGGTTTTATTTTTACCCGCACGTCGCGCCAACACAGCTGCCCTGGTATCCCCAAGGCGTCATCTCCACCGACAGGTACTTATTCTGGGTTCAGTTACATTTGCCTGCAACTTAGTACCTTCCAAGCCTCTGTGCGTGGAGTCCTTCCAGGAGTTCCCACCTCTGGGTCGTTTCGCT  Daimio_tethys             

Eagris_tetrastigma           GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTTCCGACCTGGGCCACTCCATCCCGATAATGTGTGGATGGCTGCGTCGTGCCGCGTATCCTCCCTGTAGGCCCCCCTCCCGGACCCTCTTTAGGTGCGCCAACATTACCGAGCTCTCGTGCTCCCCTACAAATTAGGACCGTCCAAGGCTTGTACTTTCCAGCTCTGATGGTTATATTTTCACCRGCACGTCGTGCCATCACAATTGCCCTGGTATCYTCAYGACGTCATCTCCACCGACAGGAACTTATTCTGGGTCCAGTCACATATGTTTGCAACCTTGTACCTTCCAAGCCTCTGTGTGTGGAGTCTTTCCAGGAGTTCCCTCCTCTTGGTCGTTTCGCT  Eagris_tetrastigma        

Darpa_striata                -----GGTTACAATCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACTCCATCTCAATAATGTGCGGATGGCAACGTCGCGTCGTGTATCCTCCTTCTAGGCTCCTCTCCCGGACCCTTTTCTGGTGCGACAATATTACTGAATTCTAGTTTTCCCCTGCAAATTAGGACCGTCCAAGGCTTGTACTCACCTGCTTCGATGGCATTATTTGCACCTGCACGTCGTGCCATCACAGCTGCCCTGGTATCTTCAAGKTGTCATCTCTATTGACAAGTACTTATTCTGGGATCAATTACATCTGTCCGTAACCTAGTACCTTCCAAGCCTCTTTGTGTGGAGTCCTTCCAGGAATTCCCACCCCTTGGTCGTTTTGCT  Darpa_striata             

Celaenorrhinus_leona         GAATTGGTTACAACCCTGCTGCCGTCGCGTAACTCCCGACCTGGGGCACTCAATCTCGATAATGTGCAGATGGCTACATCGTATTACGCATCCGCCACCCAGGCTCCTCTCCCGGACCCTTTTTTAGTGTGACAATATTACCCAGTTTTTATCTTCCCCTAAAAATTTGGACCGTCCAAGGCTTGTACTTTCCAGCTTTGATGGTTTTACTCTTACCCGCCCGGTGTGCCAACGCAGCTGCCCAGGTATCTATCTGGTGTCTTCTCCATAGACAGGTACTTATTATGAGCTCAATTACGTATGTTTGTAACCTAGTACCTTCCAAGCC-------------------------------------------------  Celaenorrhinus_leona      

Alenia_namaqua               AGATTGGTTACAACCCAGCTGCCGTTGCGTAACTCCCGATCTGGGCCACACCATCTCGATAATATGTAGATGGCTACGTTGTATTGCGCATCCGCCACCTAGGCTCCTCTCCCGGACTCTCTTTTAGTGAGTCAATATTACTGAGTTCTTATCTTCCCCTATAAATTTCCACCATCCAAGGCTTGTACTTTCCAGCTTCGATGGCTTTATTATTCACCGCACGTCGTGCCAACGCAGCTGTCCAGGTATCTACTTGATGTCTTCTCCATTGACAGGTACTTATTGTGAGATCAGTCACATTTGTCCGTAATCTTGTACCCTCGAAGCCTCTGTGTGTGGAGTCCTTCCAAGAATTCCCACCTCTCGGACGTTTTGCT  Alenia_namaqua            

Eretis_plistonicus           GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTAGGCCACCCCATCTTGATCAGGTGCGGACAGCTACGTCGTGCTGTGGATCCGCCATCTAGGCTTCTCTCCCGAACCCTCTTTTAGTGAGACAATATTACCGAGATCTTATCTCCCCCTAAAAATTTGAACCGTCCAAGGCTTGTACTTTCCTGCAGTGATGGTTTTATTTTTATCCGCTCGTTGAGTCAACGCAGCTACCCAGGTATCTACATGATGTCACCTCCATAGATAGGTACTTATTTTGGGGTCAATCACATTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAATTCCCACCTCTGGGTCGTTTTGCC  Eretis_plistonicus        

Sarangesa_bouvieri           GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGGTACCCCATCTCGATCAAGTGTGGACGGCTACGTCRTGCTATGCATCCGCCATTTAGGCTCCTCTCCCTAATCCTTTTTTAGTGCGACAATATTACCAAGTTCTTGTCTCCCCCTAAAAATTTGAACCGTCCAAGGCTTGTACTTTCCAGCTTCGATGGCTTTATTATTACCCGCTCGTTGAGCTAACGCAGTTGCCCAGGTATCTACATGGTGTCACCTCCGTAGATAGGTACTTATTTTGGGGTCAATCACATTTGTCTGTAACCTAGTACCTTCTAAGCCTCTGTGTGTGGAGTCCTTCCA----------------------------  Sarangesa_bouvieri        

Pseudocoladenia_dan          AGATTGGTTACAATCCAGCTGCCGTCGCGTAACTCCCGACCTGGACCACCCCATCTCGATCAAGTGCGGATGGCTACGTCATGCTGTGTATCTACCATTTCGGCTCCTCTCCCGAATCCTTTTTTAGTGCGGCAATGTGACTGAGTTCTTATCTTCCCCTAAAAATTTGAACCATCCAAGGCTTGTACTTTCCAGCTTCGATGGTTTTATTCTTACCCGCTCGTTGAGCCAACGCAGCTGCCCGGGTGTCTACATGGTGTCACCTTCGTAGATAAGTACTTATTTTGGGGTCAATCACATTCGTCTGTAACTTAGTACCTTCCAAGCCTCTATGTGTGGAGTCTTTCCAGGAATTCCCACCTCTGGGTCGTTTTGCC  Pseudocoladenia_dan       

Celaenorrhinus_eligius       -AATTGGTTACAATCCAGCTGCCGTCGCGTAACTCCCGACCTGGGGCACCCCATCACGATAATGTGCGGATGGCTACGTTGTACTACGCATCCGCCGTCTCGGCTCCTCTCCCGGACTCTTTTTTAGTGCGTCAATATTACCGAGTTCTCATCTACCCCTAAAAATTTGGACCATCCAAGGCTTGTACTTTCCAGCTTCGATGGTTTTATTTTTACCCACACGTTGAGCCAACACAGCTACCCAGGTATCCTCATGGTGTCACTTCCATAGACAAGTACTTAATTTGGGGTAAATCACATTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAATTCCCTCCTCTTGGTCGTTTCGCT  Celaenorrhinus_eligius    

Gorgythion_begga             GGATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACTTGGGCCACCCCATCTCGATAATGTGCGGATGGCTAAGTCCTACTGCGCATCCGCCATTCAGGCCCCTCTCCCGGACCCTCTTTAAGTGCGGCAATGTTACCCAGTTCTTGTTTTCCCCTATAAATTTGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTTTATTCTTACCCGCACGTCGTGCCATCACAGTTGCCCTGGTATCCCCAAGGTGTCATCTCCACTGATAGGAACTTATTGTGGGTTCAATTACATATGCCTGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Gorgythion_begga          

Theagenes_dichrous           GGATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTTAGGCCTCTCTCCCAGACCCTCTTTAAGTGCGGCAATGTTACCCAGTTCTTATCTTCCCCTATAAATTGGGACCATCCAAGGCTTGCACCTTTCAGCTTCGATGGTTTTATTCTTACCCACACGTCGTGCCATCACAGCTGCCCTGGTATCCCCAAGGTGTCACCTCCACAGATAGGATCTTATTCTGGGCTTAATTACATATGTCTGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCT  Theagenes_dichrous        

Timochares_trifasciata       --ATCGGATACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCTATCTCGATAACGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTCAGCCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTACCCGCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTCTATTTTTACCCACACGTCGTGCCACCACAACTGCCCTGGTACCCCCAAGGTGTCATCTCCACTGACAGGAACTTATTATGGGGTCAATTACATTTGTCTGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Timochares_trifasciata    

Camptopleura_auxo            GGATCGGATACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATCTAGCCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTACCCTCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTCTATTCTTACCCACACGACGTGCCACCACAGCTGCCCTGGTACCCCCAAGGTGTCATCTCCACTGACAGGAACTTATTGTGGGGTCAATTACATTTGTCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Camptopleura_auxo         

Helias_phalaenoides          GAATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCAATCTCGATAATGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTCAGGCCACTCTCCCTGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTATCCTCCCCTATAAATGGGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTTTATTCTTACGGACACGTCGTGCCACCACAGGTGCCCTGGTACCTCCAAGGTGTCATCTCCACTGACAGGAACAATTTGTGGGTTCAATTACATTTGTCTGCAACCTAGTACCCTCTAAGCCTCTGTGTGT----------------------------------------  Helias_phalaenoides       

Ebrietas_anacreon            GGATTGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCAATCTCGATAACGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTCCGGCCCCTCTCCCGGACCCTCCTTTAGTGCGACAATGTTACCCAGTTCTTACCCTCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTCTATACCTACCCACACGTCGTGCCACCACAGCTGCCCCGGTACCCCCAAGGTGTCATCTCCACTGACAGGAACTTATTGTGGGGTCAATTACATTTGTCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Ebrietas_anacreon         

Ebrietas_infanda             GGATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCTGACCTGGGCCACCCAATCTCGATAACGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTCCGCCCCCACTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTATCCTCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTTCAGCATCGATGGTTCTATTCCTACCCACACGTCGTGCCATCACAACTGCCCTGGTACCTCCAAGGTGTCATCTCCACTGACAGGAACTTATTGTGGGTTCAATTACATTTGTCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAAGAGTTCCCACCCCTTGGTCGTTTCGCT  Ebrietas_infanda          

Sostrata_bifasciata          GGATTGGTTACAACCCAGTTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAACGCCCGGACGGCTCCGTCCTACTGCGCATCCGCCATTTAGCCCGCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTACCTTCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTTCTGCGTCGATGGTTCTATTTTTACCCACACGTCGCGCCATCACAGCTGCCCTGGTATCCCCAAGGTGTCATCTCCACAGACAGGAACTTATTGTGGGGTCAATTACATTTGCCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGGCGTTTCGCT  Sostrata_bifasciata       

Mylon_pelopidas              GGATCGGTTACAACCCAGTTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGGGCGGATGGCTACGTCCTACCGCGCATCCGCCAATCAGGCCCCTCTCTCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTACCCTCCCCTATAAGTTGGGACCATCCAAGGCTTGCACCTTCCGGCATCGATGGTTCTACTATTACCCACACGTCGCGCCATCACAGCTGCCCTGGTATCCCCAAGGTGTCATCTCCACAGACAGGAACTTATTGTGGGGTCAATTACATTTGCCTGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Mylon_pelopidas           

Gesta_invisus                GGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAACGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTTAGGCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTATCCTCCCCTATAAATTGGGACCATCCAAGGCTTGTACTTTCCGGCATCGATGGTTCTATTCTTACCCACACGTCGTGCCACCACAGCCGCCCTGGTATCCCCAAGGTGTCACCTCCACAGACAGGGACTTATTCTGGGCTCAATTACATTTGTCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCT  Gesta_invisus             

Erynnis_horatius             AGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTTAGCCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTATCCCCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTCCAGCATCGATGGTTTTATTCTTACCCGCACGTCGTGCCACCACAGCTGCCCTGGTATCCCCAAGGTGTCATCTCCACAGACAGGCACTTATTGTGGGGTCAATTACATTTGTCCGCAACCTAGTACCTTCCAAGCCTTTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Erynnis_horatius          

Erynnis_afranius             GGATTGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAACGTGCGGATGGCTACGTCCTACTGCGCATCCGCCATTTAGCCCCCTCTCCCGGACCCTCTTTTAGTGCGACCTTGTTACCCAGTTCTTATCCACCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTCCAGCATCGATGGTTTTATTCTTACCCGCACGTCGTGCCACCACAGCTGCCCTGGTATCCCCCAGGTGTCATCTCCACAGACAGGCACTTATTGTGGGGTCAATTACATTTGTCCGCAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Erynnis_afranius          

Antigonus_erosus             -AATCGGTTACAACCCAGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGTGGATGGCTACGTCCTGCTGCGCATCCGCCATGCAGGCCCCTCTCCCGGACCCTTCTTTAGTGCGACAATATTACCCAGTTCTTATCCCCCCCTAAAAATTGGGACCATCCAAGGCTTGTACTATCCAGCATGGATGGTTCTACTTTTACCCGCACGTCGCGCCATCACAGCTGCCCTGGTATCCTCAAGGTGTCATCTCTACAGACAGGTACTTATTCTGAGTTCAATTACATTTGTCTGTAATTTAGTACCTTCCAAGCCTTTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTT----  Antigonus_erosus          

Systasea_zampa               GAATTGGTTACAATCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGTAGATGGCTACGTCCTGCTGCGCATCCGCTATCCGAGCCCCTCTCCCGGACCCTTCTTTAGTGCGACAATGTTACCCAGTTCTTACCCCCCCCTATAAATTGGGACCATCCAAGGCTTGCACTTTCCAGCGTGGATGGTTGTATTYCTACCCGCACGTCGCGCCATCACAGCYGCCCTGGTATCCCCGAGGTGTCGTCTCCATAGACAGGTACTTATTATGAGGTCAATTACATTTGACTGTAACCTAGTACCTTCCAAGCCTCTATGTGTGGAGTCCTTCCAAGAGTTCCCACCCCTTGGTCGTTTTGCT  Systasea_zampa            

Zopyrion_sandace             -AATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGTGGATGGCTAAGTCCTGCTGTGTATCCGCCTCTCAGGCCCCTCTCCCGGACCCTCCTTTGGTGCGTCAATGTTACCCAGCTCCTACCCCCCCCTACAAATTGGGACCATCCAAGGCTTGTACTTTCCAGCCTCGACGGTTATATTTTTACCCGCACGTCGTCCCAACACAGCAGGCCTGGTATCCCCAAGGTGTCATCTCCATAGACAGATACTTATTCTGGGATTAGTTACATTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAATCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCT  Zopyrion_sandace          

Pyrgus_ruralis               -AATTGGTTACAATCCTGCTGCTGTCGCGTAACTCCCGACCTGGGCCACTCCATCCCGATAACGTGCGGATGGCTACGTCCTGCTGCGCATTCACCATCCAGGCCCCTCTCCCGGACCCTTCTTTAGTGCGAAAATGTTACCGAGTTCTTATTCTCCCCTAAAAATTGGGACCATCCAAGGCTTGCACTGTCCAGCTTAGATGGTTCTATTTCTACCCGCATGTCGTGCCATCACAGCCGCCCTGGTATCCCCAAGGTGTCATCTCTATTGACAGGTACTTATTTTGGGGTCAATTACATTTGTCTGGAACCTAGTACCCTCCAAGCCTCTATGTGTGGAGTCCTTCCAGGAGTTCCCTCCACTTGGTCGTTTTGCT  Pyrgus_ruralis            

Pyrgus_scriptura             GAATTGGTTACAATCCTGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTGCGGATGGCTACGTCCTGCTGCGCATCCTCCATCCAGGCCCCTCTCCCGGACCCTTCTTTAGTGAGAAAATGTTACCGAGTTCTTATTCCCCCCTAAAAATTGGGACCATCCAAGGCTTGTACTGTCCAGCTTCGATGGTTCTATTCTTACCCGCATATCGTGCCATCACAGTCGCCCTGGTATCCCCAAGGTGTCATCTCTACTGACAGGTACTTATTTTGGGATCAATTACATTTGTCTGTAACCTAGTACCCTCCAAGCCTCTATGTGTGGAGTCCTTCCAGGAGTTCCCTCCCCTTGGTCGTTTCGCT  Pyrgus_scriptura          

Pyrgus_communis              -GATTGGTTACAACCCTGCTGCTGTCGCGTAACCCCCGACCTGGGCCACCCCATCCCGATAACGTGTGGATGGCTACGTCCTGCTGCGCATCCGCCATCCAGGCCCCTCTCCCGGACCCTTCTTTAGTGCGAAAATGTTACCCAGTTCTTACCCTCCCCTAAAAATTGGGACCATTCAAGGCTTGTACTTTCCAGCCTCGATGGTTGTACTCCTACCCGCACGTCGTGCCATCACAGCCGCCCTGGTATCCCCAAGGTGTCCTCTTTACCGATAGGTACTTACTCTGGGACCAATTACGTTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGACGTTTCGCT  Pyrgus_communis           

Heliopetes_alana             GGATCGGTTACAACCCTGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGTAGATGGCAACGTCGTGCTGTGTATCCGCCATCCAGGCCGCTCTCTCGGACCCTTCTTTAGTGCGAAAATATTACCCAGTTCTTATCTTCCCCTAAAAATTGGGACCATCCAAGGCTTGCACTWTCCAGCTTAGATGGTTCTACTCTAACCCGCACGTCGTGCCATCACAGCCGCCCTGGTATCCTCAAGGTGTCATCTTTACCGATAAATACTTATTCTGGGATTAATTACATTTGTTTGTAACTTAGTACCCTCTAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCT  Heliopetes_alana          

Celotes_nessus               GAATTGGTTACAACCCTGCTGCTGTCGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGCGGATGGCTACGTCCTGCTGCGCATCCGCCGTCCAGGCCCCTCTCTCGGACCCTTCTTTAGTGCGACAATGTTACCCAACTCTTATCCTCCCCTAAAAATTGGGACCATCCAAGGCTTGCACTTTTCAGCATGGATGGATCTATTTTTACCCGCACGTCGTGCCATCACAGCCGTCCTGGTATCCCCAAGGTGTCATCTCTATAGACAGGTACTTATTCTGGGATCAATTACATTTGTCTGTAACCTAGTACCCTCCAAGCCTCTGTGTGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCT  Celotes_nessus            

Eracon_lachesis              GAATCGGATACAACCCAGCTGCCGTGGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAACGTCTGGATGGCTACATCTTGCCGTGTATCCGCCACTCAGGCCTCTCTCCCGGACCCTCTTTTAGTGMGACAATGTTACCGAGCTCTTATCCCCCCCTATAAGTTGGGACCATCCAAGGCTTGTACTTTCCCGCCCCAATGGTTCTATTTTTACCCGCACGTCGCGCCATCACAGCTGCCCTGGTACCTCCAAGGCGTCTTCTCCACAGACAGGAACTTATTATGGGGTCACTCACATTTGTCTGTAACCTGGTACCCTCCAAGCCCCTGTGCGTGGAGTCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTTGCT  Eracon_lachesis           

Clito_aberrans               GGATCGGTTACAACCCAGCTGCCGTTGCGTAACTCCCGACCTGGGCCACCCCATCCCGATAATGTGCGGACGGCTACGTCCCGCTGCGCATCCGCCATTTAGGCCTCTCTCCCGGACCCTCTTTTAGTGCGACAATGTTACCCAGTTCTTGTCCTCCCCTATAAGTCGGGACCATCCAAGGCTTGTACCTTCCAGCATCGATGGTTCTACTCTTACCCGCACGTCGTGCCACCACAGCTGCCCTGGTATCCCCAAGGTGTCACCTCCGCAGACAGGTACCTATTCTGGGCCCAATTACATTTGCTTGAAACTTAGTACCTTCCAAGCCTCTGTGTGTGGAATCCTTCCAGGAGTTCCCACCCCTTGGTCGTTTCGCC  Clito_aberrans            

Quadrus_cerialis             ---------------------------CGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTACGTCCTGCTGCGCATCCGCCATTTAGGCCCCTCTCCCGGACCCTCTTTTAGTGCGACAAGGTTACCTAACTCTTATCCTCCCCTATAAGTTGGGCCCATCCAAGGCTTGTACTTTCCAGCTTCGATGGTTATATTTTTACCCGCACGTCGCGCCTTCACAGCCGCCCTGGTATCCCCATGGCGTCATCTTCACAGATAGGTACTTATTCTGGGTTTAATTACATTTGTCTGCAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAATCCTTCCAGGAATTCCCACCCCTTGGACGTTTTGCT  Quadrus_cerialis          

Pythonides_jovianus          --------------------CCCGGCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTACGTCCTGCTGTGCATCCGCCATTTAGCCCCCTCTCCCGGACCCTCTTTTACTCCGACAACGTTACCCAGTCCTTATCCTCCCCTATAAGTCGGGACCATCCAAGGCTTGTACTTTCCAGCTTCGATGGTTCTACTYTTACCCGCACGTCGTGCCATCACAGCCGCTTTGGTATCCTCGCGGCGTCATCTTCGTAGACAGAAACTTACCGTGAGTTCAATTACATTTGTCCGCAACTTAGTACCTTCCAAGCCCCTGTGTGTGGAATCCTTCCAGGAATTCCCACCTCTTGGACGTTTTGCT  Pythonides_jovianus       

Milanion_marciana            GAATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCCATCTCGATAATGTGTGGACGGCTAAATCCTGTTGCGCATCCGCCATTTAAGCCCCTCTCCCGGATCCTTTCACTGTGAGACAAGATTGCCTAATTCTTGTCTTCTCTTAAAAATTAGAACCATTCAAGGCTTGTACTTTCCAGCTGCGATGATTGTATTTTTACCCACACATCGTGCCATCACAGCCGTCTTGGCATCTTCATGCTGTCATTTTCATAGACAAGAACTTATTATGAGATCAATCACATTTGTTTGAAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAATCCTTCCAAGAATTCCCACCTCTTGGGCGTTTTGCT  Milanion_marciana         

Atarnes_sallei               -AATCGGTTACAACCCAGCTGCAGTCGCGTAACTCCCGACCTGGGCCACCCCATCACGATAATGTGCGGACGGCTAAATCCTGTTGCGCATCCGCCATTTAGGCCCCTCTCCCGGATCCTTCTACTGTGCGGCAAGATTGCCCAATTCATATCTTCCCTTAAAAATTAGAACCATCCAAGGCTTGTACTTTCCAGCTGCGATGGTTGTATTTTTACCCACACATAGTGCCATCACAGCTGTCCTGGTATTCTCACGCTGTCATCTTCATAGACAGGAACTTATTATGAGATCAATCACATTTGTCTGTAACCTAGTACCTTCCAAGCCTCTGTGTGTGGAATCCTTCCAGGAATTCCCACCTCTTGGGCGTTTTGCT  Atarnes_sallei            

Achlyodes_busirus            -AATCGGATACAACCCAGCTGCCGTCGCGTTACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTAAATCCTGTTGCGCATCCGCCATTTAGGCCCCTCTCCCGGACCCTCTTTTAGTGCGACAATGTWGACTAATTCTTATCTCCCCCTATAAATTGGGACCATCCAAGGCTTGTACTTTCCAGCACCRATGGTTCTACTCCAACCCGCACGTCTTGCCACCACAGCTGCCCTGGTATCCCTTCGGTGTCATCTTCATCGACGGGAACTTATTATGGGATCAATTACATTTGCCTGAAACCTAGTACCTTCCAAACCTCTGTGCGTGGAATCCTTCCAGGAGTTCCCACCCCTAGGTCGTTTTGC-  Achlyodes_busirus         

Aethilla_lavochrea           GAATCGGTTACAACCCAGCTGCCGTCGCGTGACTCCCGACCTGGGCCACCCCATCTCGATAATGTGCGGATGGCTAAGTCCTGATGCGCATCCGCCATTCAGGCTCCTCTCCCGGATCCTCTTTTAGTGCGACAATGTTGACTAGTTCTTATCTCCCCCTAAAAATTGGGACCATCCAAGGCTTGTACTTTCCAGCTTCGATGGTTCTACTCCAACCCGCACGTCTTGCCACCACAGCTGCCCTGGTATCCCTTAGGTGTCATCTTCATAGACGGGAACTTATTGTGGGATCAATCACATTTGTCTGAAACCTAGTACCTTCCAAACCTCTGTGTGTGGAATCCTTCCAGGAGTTCCCACCTCTAGGTCGTTTTGCC  Aethilla_lavochrea        

Cyclosemia_anastomosis       -------TTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGGCCACCCTATCTCGATAATGTGCGGATGGCTACATCCTGTTGCGCATCCACCATTCAGGCCCCTCTCCCAAACGCTCTTTTAGTGAGACAATGTTACCCAGCTCTTATTTTCCCCTATAAATTAGGACCATCCAAGGCTTGTACTATCCAGCGTCGATGGTTTTATTCCTCACCACACGTAGTGCCATCACAGCCGCCCTCCTATCCTCAAGGTGTCATCTACACAGACAGGAACTTATTATGAGGTCAATTACAATTGTCTGAAACCTAGTACCCTCCAAGCCTTTGTGCGTGGAGTCCTTCCAAGAATTCCCACCCCTGGGTCGTTTTGCT  Cyclosemia_anastomosis    

Pachyneuria_lineatopunctata  AGATCGGTTACAACCCAGCTGCCGTCGCGTAACTCCCGACCTGGACCACCCTATCTCGGTGCTGTGTGGACGGCTCTATCTTGTTGTGAATCCGCGATTCAGGCACAACTCCCGAACGCTTTTTAGGTGAGACAATATTGCCGAGTTCTTGCTTACCCCTATAAATTAGGACCATCCAAGGCTTGTACTATCCTGCTTAGATGGTTTTATTTTTACCCGCACGTCGTGCCATCCCAGTTGCCCTGGTATCTCCGTGGTGTCATCTCCATAGACAGGTACTTATTATGGGGTCAATTACATTTGTCTGTAAC